Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320461954:

Variant ID: vg0320461954 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20461954
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGTTTTGCT[T/C]
CTTTCTGTTTAGATTCCGACGTTTCCGGAGAGTCCGTTTTCGTAGGAGAAGAATTTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACATAGATCCCAAAC

Reverse complement sequence

GTTTGGGATCTATGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAAATTCTTCTCCTACGAAAACGGACTCTCCGGAAACGTCGGAATCTAAACAGAAAG[A/G]
AGCAAAACACCAAAACAGCACATAAACAAGCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	32.80%	13.99%	0.47%	NA
All Indica	2759	78.10%	3.10%	18.01%	0.80%	NA
All Japonica	1512	2.10%	87.60%	10.32%	0.00%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	92.30%	1.80%	5.04%	0.84%	NA
Indica II	465	74.80%	3.40%	21.51%	0.22%	NA
Indica III	913	69.80%	1.50%	28.04%	0.66%	NA
Indica Intermediate	786	79.00%	5.60%	14.12%	1.27%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	66.50%	28.17%	0.00%	NA
Japonica Intermediate	241	1.20%	92.90%	5.81%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	41.10%	50.00%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320461954	T -> C	LOC_Os03g36880.1	upstream_gene_variant ; 763.0bp to feature; MODIFIER	silent_mutation	Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0320461954	T -> C	LOC_Os03g36870.1	downstream_gene_variant ; 3101.0bp to feature; MODIFIER	silent_mutation	Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0320461954	T -> C	LOC_Os03g36890.1	downstream_gene_variant ; 4591.0bp to feature; MODIFIER	silent_mutation	Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0320461954	T -> C	LOC_Os03g36870-LOC_Os03g36880	intergenic_region ; MODIFIER	silent_mutation	Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0320461954	T -> DEL	N	N	silent_mutation	Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320461954	NA	7.91E-10	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954	1.38E-07	1.12E-18	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954	NA	2.14E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954	1.73E-08	1.07E-15	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954	3.14E-06	1.03E-22	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954	NA	8.69E-08	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251