\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320461954:

Variant ID: vg0320461954 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20461954
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGTTTTGCT[T/C]
CTTTCTGTTTAGATTCCGACGTTTCCGGAGAGTCCGTTTTCGTAGGAGAAGAATTTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACATAGATCCCAAAC

Reverse complement sequence

GTTTGGGATCTATGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAAATTCTTCTCCTACGAAAACGGACTCTCCGGAAACGTCGGAATCTAAACAGAAAG[A/G]
AGCAAAACACCAAAACAGCACATAAACAAGCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 32.80% 13.99% 0.47% NA
All Indica  2759 78.10% 3.10% 18.01% 0.80% NA
All Japonica  1512 2.10% 87.60% 10.32% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 92.30% 1.80% 5.04% 0.84% NA
Indica II  465 74.80% 3.40% 21.51% 0.22% NA
Indica III  913 69.80% 1.50% 28.04% 0.66% NA
Indica Intermediate  786 79.00% 5.60% 14.12% 1.27% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 5.40% 66.50% 28.17% 0.00% NA
Japonica Intermediate  241 1.20% 92.90% 5.81% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 41.10% 50.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320461954 T -> C LOC_Os03g36880.1 upstream_gene_variant ; 763.0bp to feature; MODIFIER silent_mutation Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0320461954 T -> C LOC_Os03g36870.1 downstream_gene_variant ; 3101.0bp to feature; MODIFIER silent_mutation Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0320461954 T -> C LOC_Os03g36890.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0320461954 T -> C LOC_Os03g36870-LOC_Os03g36880 intergenic_region ; MODIFIER silent_mutation Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0320461954 T -> DEL N N silent_mutation Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320461954 NA 7.91E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954 1.38E-07 1.12E-18 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954 NA 2.14E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954 1.73E-08 1.07E-15 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954 3.14E-06 1.03E-22 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320461954 NA 8.69E-08 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251