\
| Variant ID: vg0320461954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20461954 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGCTTGTTTATGTGCTGTTTTGGTGTTTTGCT[T/C]
CTTTCTGTTTAGATTCCGACGTTTCCGGAGAGTCCGTTTTCGTAGGAGAAGAATTTGAAGAGTTCCAAGGCCAGCAAGGCAAGTCACATAGATCCCAAAC
GTTTGGGATCTATGTGACTTGCCTTGCTGGCCTTGGAACTCTTCAAATTCTTCTCCTACGAAAACGGACTCTCCGGAAACGTCGGAATCTAAACAGAAAG[A/G]
AGCAAAACACCAAAACAGCACATAAACAAGCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 32.80% | 13.99% | 0.47% | NA |
| All Indica | 2759 | 78.10% | 3.10% | 18.01% | 0.80% | NA |
| All Japonica | 1512 | 2.10% | 87.60% | 10.32% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.30% | 1.80% | 5.04% | 0.84% | NA |
| Indica II | 465 | 74.80% | 3.40% | 21.51% | 0.22% | NA |
| Indica III | 913 | 69.80% | 1.50% | 28.04% | 0.66% | NA |
| Indica Intermediate | 786 | 79.00% | 5.60% | 14.12% | 1.27% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 66.50% | 28.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 92.90% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 50.00% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320461954 | T -> C | LOC_Os03g36880.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0320461954 | T -> C | LOC_Os03g36870.1 | downstream_gene_variant ; 3101.0bp to feature; MODIFIER | silent_mutation | Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0320461954 | T -> C | LOC_Os03g36890.1 | downstream_gene_variant ; 4591.0bp to feature; MODIFIER | silent_mutation | Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0320461954 | T -> C | LOC_Os03g36870-LOC_Os03g36880 | intergenic_region ; MODIFIER | silent_mutation | Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0320461954 | T -> DEL | N | N | silent_mutation | Average:10.77; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320461954 | NA | 7.91E-10 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320461954 | 1.38E-07 | 1.12E-18 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320461954 | NA | 2.14E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320461954 | 1.73E-08 | 1.07E-15 | mr1718_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320461954 | 3.14E-06 | 1.03E-22 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320461954 | NA | 8.69E-08 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |