\
| Variant ID: vg0320452783 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20452783 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )
TCATCAATAATCCCAAACACAGGAGTAGGGTGTTACGCTCTATAGCGGCCCAAACCTGTATAATCCCACTACGTGCAAGCTTGCCGGTAATCTTAGGGAC[G/A]
AGCGAGTGATTTCCGAGAGGCGGGCCTCCGCCCCCGGCCGAACTCACGAAAGGGGGGGTCTCACGACCTCCCGCTATCGGGGGGCCATCCCTCGACAGCT
AGCTGTCGAGGGATGGCCCCCCGATAGCGGGAGGTCGTGAGACCCCCCCTTTCGTGAGTTCGGCCGGGGGCGGAGGCCCGCCTCTCGGAAATCACTCGCT[C/T]
GTCCCTAAGATTACCGGCAAGCTTGCACGTAGTGGGATTATACAGGTTTGGGCCGCTATAGAGCGTAACACCCTACTCCTGTGTTTGGGATTATTGATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.60% | 30.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320452783 | G -> A | LOC_Os03g36860.1 | upstream_gene_variant ; 287.0bp to feature; MODIFIER | silent_mutation | Average:67.367; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0320452783 | G -> A | LOC_Os03g36830-LOC_Os03g36860 | intergenic_region ; MODIFIER | silent_mutation | Average:67.367; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320452783 | NA | 2.55E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 1.65E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | 2.56E-07 | 2.57E-07 | mr1362 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | 3.93E-06 | NA | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 2.96E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 1.42E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 6.95E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 6.27E-08 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 1.10E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 2.56E-10 | mr1852 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320452783 | NA | 6.38E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |