\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320438537:

Variant ID: vg0320438537 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20438537
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCGGGGCCAGGGCCAGGGATACCCGCATAAGGGCGGGGACGGGGGCATTCCGATCCAACCCGGCCCTGCCCCGCCCTGTTGCCACCGCTAGATCCATC[G/T,A]
AATAAGCGATGTTGATTAGAAGGTCATTTGTTGAGAGTGAGAAGATCTATACTGGCCAAATGTCTAGGTTTTATGGCTCAAATAATGCATGTATATATAT

Reverse complement sequence

ATATATATACATGCATTATTTGAGCCATAAAACCTAGACATTTGGCCAGTATAGATCTTCTCACTCTCAACAAATGACCTTCTAATCAACATCGCTTATT[C/A,T]
GATGGATCTAGCGGTGGCAACAGGGCGGGGCAGGGCCGGGTTGGATCGGAATGCCCCCGTCCCCGCCCTTATGCGGGTATCCCTGGCCCTGGCCCCGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 8.90% 14.52% 44.18% A: 0.04%
All Indica  2759 2.70% 8.10% 21.57% 67.63% NA
All Japonica  1512 86.80% 10.40% 1.12% 1.46% A: 0.13%
Aus  269 9.70% 10.40% 21.93% 57.99% NA
Indica I  595 2.20% 5.00% 17.98% 74.79% NA
Indica II  465 2.80% 6.20% 27.31% 63.66% NA
Indica III  913 1.20% 10.80% 21.58% 66.37% NA
Indica Intermediate  786 4.70% 8.40% 20.87% 66.03% NA
Temperate Japonica  767 99.60% 0.10% 0.13% 0.13% NA
Tropical Japonica  504 65.10% 28.20% 3.17% 3.57% NA
Japonica Intermediate  241 91.70% 6.20% 0.00% 1.24% A: 0.83%
VI/Aromatic  96 75.00% 3.10% 5.21% 16.67% NA
Intermediate  90 48.90% 8.90% 11.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320438537 G -> T LOC_Os03g36810.1 downstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0320438537 G -> T LOC_Os03g36810-LOC_Os03g36830 intergenic_region ; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0320438537 G -> A LOC_Os03g36810.1 downstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0320438537 G -> A LOC_Os03g36810-LOC_Os03g36830 intergenic_region ; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0320438537 G -> DEL N N silent_mutation Average:62.74; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320438537 NA 8.56E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 9.29E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 8.60E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 3.58E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 6.30E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 8.55E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 5.77E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 4.92E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 4.95E-06 4.95E-06 mr1439 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 3.91E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 4.02E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 3.63E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 2.18E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 9.19E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 2.07E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 1.20E-12 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 7.99E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 3.76E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 NA 1.05E-106 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320438537 8.28E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251