Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320220294:

Variant ID: vg0320220294 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20220294
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.27, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCATTTGCAAAAGCAGTATTTAGCAAATATTTAAGAATAGTAAAACAGTAGAGTAATCATCAATTTTAATCAACACTGAACAGCACACCCATGCTGCT[C/T]
AGGCCCAACCATTCTGAACAACCAAACCCGGCTGCACAGATCTAACTCCATACCAGGAGCTAAGCAAATTATTACCAATTATAGCATCAATAATTATTGT

Reverse complement sequence

ACAATAATTATTGATGCTATAATTGGTAATAATTTGCTTAGCTCCTGGTATGGAGTTAGATCTGTGCAGCCGGGTTTGGTTGTTCAGAATGGTTGGGCCT[G/A]
AGCAGCATGGGTGTGCTGTTCAGTGTTGATTAAAATTGATGATTACTCTACTGTTTTACTATTCTTAAATATTTGCTAAATACTGCTTTTGCAAATGAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	32.90%	0.83%	0.19%	NA
All Indica	2759	95.00%	4.20%	0.51%	0.33%	NA
All Japonica	1512	12.80%	85.70%	1.52%	0.00%	NA
Aus	269	89.60%	10.00%	0.37%	0.00%	NA
Indica I	595	97.10%	2.70%	0.17%	0.00%	NA
Indica II	465	93.30%	5.80%	0.65%	0.22%	NA
Indica III	913	95.90%	3.10%	0.44%	0.55%	NA
Indica Intermediate	786	93.10%	5.70%	0.76%	0.38%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.20%	0.00%	NA
Japonica Intermediate	241	7.50%	83.40%	9.13%	0.00%	NA
VI/Aromatic	96	25.00%	74.00%	1.04%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320220294	C -> T	LOC_Os03g36520.1	upstream_gene_variant ; 1219.0bp to feature; MODIFIER	silent_mutation	Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0320220294	C -> T	LOC_Os03g36500.1	downstream_gene_variant ; 2072.0bp to feature; MODIFIER	silent_mutation	Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0320220294	C -> T	LOC_Os03g36500-LOC_Os03g36520	intergenic_region ; MODIFIER	silent_mutation	Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N
vg0320220294	C -> DEL	N	N	silent_mutation	Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320220294	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	2.46E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	7.10E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	2.08E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	3.53E-07	NA	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	7.59E-14	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294	NA	1.28E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251