\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320220294:

Variant ID: vg0320220294 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20220294
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.27, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCATTTGCAAAAGCAGTATTTAGCAAATATTTAAGAATAGTAAAACAGTAGAGTAATCATCAATTTTAATCAACACTGAACAGCACACCCATGCTGCT[C/T]
AGGCCCAACCATTCTGAACAACCAAACCCGGCTGCACAGATCTAACTCCATACCAGGAGCTAAGCAAATTATTACCAATTATAGCATCAATAATTATTGT

Reverse complement sequence

ACAATAATTATTGATGCTATAATTGGTAATAATTTGCTTAGCTCCTGGTATGGAGTTAGATCTGTGCAGCCGGGTTTGGTTGTTCAGAATGGTTGGGCCT[G/A]
AGCAGCATGGGTGTGCTGTTCAGTGTTGATTAAAATTGATGATTACTCTACTGTTTTACTATTCTTAAATATTTGCTAAATACTGCTTTTGCAAATGAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 32.90% 0.83% 0.19% NA
All Indica  2759 95.00% 4.20% 0.51% 0.33% NA
All Japonica  1512 12.80% 85.70% 1.52% 0.00% NA
Aus  269 89.60% 10.00% 0.37% 0.00% NA
Indica I  595 97.10% 2.70% 0.17% 0.00% NA
Indica II  465 93.30% 5.80% 0.65% 0.22% NA
Indica III  913 95.90% 3.10% 0.44% 0.55% NA
Indica Intermediate  786 93.10% 5.70% 0.76% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 7.50% 83.40% 9.13% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320220294 C -> T LOC_Os03g36520.1 upstream_gene_variant ; 1219.0bp to feature; MODIFIER silent_mutation Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0320220294 C -> T LOC_Os03g36500.1 downstream_gene_variant ; 2072.0bp to feature; MODIFIER silent_mutation Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0320220294 C -> T LOC_Os03g36500-LOC_Os03g36520 intergenic_region ; MODIFIER silent_mutation Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N
vg0320220294 C -> DEL N N silent_mutation Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320220294 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 2.46E-08 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 2.08E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 3.53E-07 NA mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 7.59E-14 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320220294 NA 1.28E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251