\
| Variant ID: vg0320220294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20220294 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.27, others allele: 0.00, population size: 63. )
GCTCATTTGCAAAAGCAGTATTTAGCAAATATTTAAGAATAGTAAAACAGTAGAGTAATCATCAATTTTAATCAACACTGAACAGCACACCCATGCTGCT[C/T]
AGGCCCAACCATTCTGAACAACCAAACCCGGCTGCACAGATCTAACTCCATACCAGGAGCTAAGCAAATTATTACCAATTATAGCATCAATAATTATTGT
ACAATAATTATTGATGCTATAATTGGTAATAATTTGCTTAGCTCCTGGTATGGAGTTAGATCTGTGCAGCCGGGTTTGGTTGTTCAGAATGGTTGGGCCT[G/A]
AGCAGCATGGGTGTGCTGTTCAGTGTTGATTAAAATTGATGATTACTCTACTGTTTTACTATTCTTAAATATTTGCTAAATACTGCTTTTGCAAATGAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 32.90% | 0.83% | 0.19% | NA |
| All Indica | 2759 | 95.00% | 4.20% | 0.51% | 0.33% | NA |
| All Japonica | 1512 | 12.80% | 85.70% | 1.52% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.30% | 5.80% | 0.65% | 0.22% | NA |
| Indica III | 913 | 95.90% | 3.10% | 0.44% | 0.55% | NA |
| Indica Intermediate | 786 | 93.10% | 5.70% | 0.76% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 83.40% | 9.13% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 74.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320220294 | C -> T | LOC_Os03g36520.1 | upstream_gene_variant ; 1219.0bp to feature; MODIFIER | silent_mutation | Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg0320220294 | C -> T | LOC_Os03g36500.1 | downstream_gene_variant ; 2072.0bp to feature; MODIFIER | silent_mutation | Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg0320220294 | C -> T | LOC_Os03g36500-LOC_Os03g36520 | intergenic_region ; MODIFIER | silent_mutation | Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| vg0320220294 | C -> DEL | N | N | silent_mutation | Average:59.25; most accessible tissue: Zhenshan97 flag leaf, score: 84.441 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320220294 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 2.46E-08 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 7.10E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 2.08E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | 3.53E-07 | NA | mr1718_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 7.59E-14 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320220294 | NA | 1.28E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |