Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320175080:

Variant ID: vg0320175080 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20175080
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCACGCCCACCCTTGCCTGGATGCGTCAGCTAGAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATGAGTTCTTC[T/C]
AGGGCATCCCGCGAACCGGTCCTTAACTGCCATGGGTGCGACTAGCAAAACCATGCACCCACAGCCCATCATGTGATTCATTTTAATTAACCAACACCGA

Reverse complement sequence

TCGGTGTTGGTTAATTAAAATGAATCACATGATGGGCTGTGGGTGCATGGTTTTGCTAGTCGCACCCATGGCAGTTAAGGACCGGTTCGCGGGATGCCCT[A/G]
GAAGAACTCATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCTGACGCATCCAGGCAAGGGTGGGCGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	33.40%	1.74%	0.00%	NA
All Indica	2759	93.80%	4.20%	2.07%	0.00%	NA
All Japonica	1512	11.60%	86.90%	1.46%	0.00%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	91.90%	2.90%	5.21%	0.00%	NA
Indica II	465	94.20%	4.10%	1.72%	0.00%	NA
Indica III	913	96.90%	2.60%	0.44%	0.00%	NA
Indica Intermediate	786	91.20%	7.00%	1.78%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	31.00%	68.70%	0.40%	0.00%	NA
Japonica Intermediate	241	7.50%	84.20%	8.30%	0.00%	NA
VI/Aromatic	96	24.00%	74.00%	2.08%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320175080	T -> C	LOC_Os03g36390.1	upstream_gene_variant ; 1026.0bp to feature; MODIFIER	silent_mutation	Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0320175080	T -> C	LOC_Os03g36370.1	downstream_gene_variant ; 4706.0bp to feature; MODIFIER	silent_mutation	Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0320175080	T -> C	LOC_Os03g36380.1	downstream_gene_variant ; 1475.0bp to feature; MODIFIER	silent_mutation	Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0320175080	T -> C	LOC_Os03g36400.1	downstream_gene_variant ; 2154.0bp to feature; MODIFIER	silent_mutation	Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0320175080	T -> C	LOC_Os03g36380-LOC_Os03g36390	intergenic_region ; MODIFIER	silent_mutation	Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320175080	NA	6.79E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	1.84E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	1.92E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	2.41E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	5.65E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	1.88E-07	1.88E-07	mr1987	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	3.35E-17	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080	NA	4.92E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251