\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320175080:

Variant ID: vg0320175080 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20175080
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCACGCCCACCCTTGCCTGGATGCGTCAGCTAGAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATGAGTTCTTC[T/C]
AGGGCATCCCGCGAACCGGTCCTTAACTGCCATGGGTGCGACTAGCAAAACCATGCACCCACAGCCCATCATGTGATTCATTTTAATTAACCAACACCGA

Reverse complement sequence

TCGGTGTTGGTTAATTAAAATGAATCACATGATGGGCTGTGGGTGCATGGTTTTGCTAGTCGCACCCATGGCAGTTAAGGACCGGTTCGCGGGATGCCCT[A/G]
GAAGAACTCATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCTGACGCATCCAGGCAAGGGTGGGCGTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 33.40% 1.74% 0.00% NA
All Indica  2759 93.80% 4.20% 2.07% 0.00% NA
All Japonica  1512 11.60% 86.90% 1.46% 0.00% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 91.90% 2.90% 5.21% 0.00% NA
Indica II  465 94.20% 4.10% 1.72% 0.00% NA
Indica III  913 96.90% 2.60% 0.44% 0.00% NA
Indica Intermediate  786 91.20% 7.00% 1.78% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 31.00% 68.70% 0.40% 0.00% NA
Japonica Intermediate  241 7.50% 84.20% 8.30% 0.00% NA
VI/Aromatic  96 24.00% 74.00% 2.08% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320175080 T -> C LOC_Os03g36390.1 upstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0320175080 T -> C LOC_Os03g36370.1 downstream_gene_variant ; 4706.0bp to feature; MODIFIER silent_mutation Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0320175080 T -> C LOC_Os03g36380.1 downstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0320175080 T -> C LOC_Os03g36400.1 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0320175080 T -> C LOC_Os03g36380-LOC_Os03g36390 intergenic_region ; MODIFIER silent_mutation Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320175080 NA 6.79E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 1.84E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 1.92E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 2.41E-13 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 5.65E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 1.88E-07 1.88E-07 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 3.35E-17 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320175080 NA 4.92E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251