\
| Variant ID: vg0320175080 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20175080 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCACGCCCACCCTTGCCTGGATGCGTCAGCTAGAGGAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGTACGATGAGTTCTTC[T/C]
AGGGCATCCCGCGAACCGGTCCTTAACTGCCATGGGTGCGACTAGCAAAACCATGCACCCACAGCCCATCATGTGATTCATTTTAATTAACCAACACCGA
TCGGTGTTGGTTAATTAAAATGAATCACATGATGGGCTGTGGGTGCATGGTTTTGCTAGTCGCACCCATGGCAGTTAAGGACCGGTTCGCGGGATGCCCT[A/G]
GAAGAACTCATCGTACTTACCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCTGACGCATCCAGGCAAGGGTGGGCGTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 33.40% | 1.74% | 0.00% | NA |
| All Indica | 2759 | 93.80% | 4.20% | 2.07% | 0.00% | NA |
| All Japonica | 1512 | 11.60% | 86.90% | 1.46% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.90% | 2.90% | 5.21% | 0.00% | NA |
| Indica II | 465 | 94.20% | 4.10% | 1.72% | 0.00% | NA |
| Indica III | 913 | 96.90% | 2.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 7.00% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.00% | 68.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 84.20% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 74.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 56.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320175080 | T -> C | LOC_Os03g36390.1 | upstream_gene_variant ; 1026.0bp to feature; MODIFIER | silent_mutation | Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0320175080 | T -> C | LOC_Os03g36370.1 | downstream_gene_variant ; 4706.0bp to feature; MODIFIER | silent_mutation | Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0320175080 | T -> C | LOC_Os03g36380.1 | downstream_gene_variant ; 1475.0bp to feature; MODIFIER | silent_mutation | Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0320175080 | T -> C | LOC_Os03g36400.1 | downstream_gene_variant ; 2154.0bp to feature; MODIFIER | silent_mutation | Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0320175080 | T -> C | LOC_Os03g36380-LOC_Os03g36390 | intergenic_region ; MODIFIER | silent_mutation | Average:27.322; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320175080 | NA | 6.79E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 1.84E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 1.92E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 2.41E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 5.65E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | 1.88E-07 | 1.88E-07 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 3.35E-17 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320175080 | NA | 4.92E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |