Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320174856:

Variant ID: vg0320174856 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20174856
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGTACCCACAAGACACAGCCCCACGACACGTTTCCGTGCGCCGACATGCCACCACGACATACCGGAAAGAGGCTGTGACAGGACCCTTTGCATAACCC[C/T]
CTCTAACCAAGCACACCACACCTTAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTTCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGC

Reverse complement sequence

GCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGAACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTAAGGTGTGGTGTGCTTGGTTAGAG[G/A]
GGGTTATGCAAAGGGTCCTGTCACAGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCACGGAAACGTGTCGTGGGGCTGTGTCTTGTGGGTACAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	39.50%	0.85%	0.06%	NA
All Indica	2759	35.20%	64.30%	0.51%	0.00%	NA
All Japonica	1512	97.80%	0.70%	1.32%	0.20%	NA
Aus	269	83.30%	16.70%	0.00%	0.00%	NA
Indica I	595	46.70%	52.60%	0.67%	0.00%	NA
Indica II	465	30.10%	69.70%	0.22%	0.00%	NA
Indica III	913	33.50%	66.00%	0.44%	0.00%	NA
Indica Intermediate	786	31.40%	67.90%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	1.60%	0.40%	0.00%	NA
Japonica Intermediate	241	90.90%	0.40%	7.47%	1.24%	NA
VI/Aromatic	96	91.70%	5.20%	3.12%	0.00%	NA
Intermediate	90	62.20%	34.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320174856	C -> T	LOC_Os03g36390.1	upstream_gene_variant ; 1250.0bp to feature; MODIFIER	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0320174856	C -> T	LOC_Os03g36370.1	downstream_gene_variant ; 4482.0bp to feature; MODIFIER	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0320174856	C -> T	LOC_Os03g36380.1	downstream_gene_variant ; 1251.0bp to feature; MODIFIER	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0320174856	C -> T	LOC_Os03g36400.1	downstream_gene_variant ; 2378.0bp to feature; MODIFIER	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0320174856	C -> T	LOC_Os03g36380-LOC_Os03g36390	intergenic_region ; MODIFIER	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0320174856	C -> DEL	N	N	silent_mutation	Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320174856	NA	9.31E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856	1.50E-06	NA	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856	1.93E-06	1.46E-08	mr1439	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856	NA	5.04E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856	NA	9.48E-08	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251