\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320174856:

Variant ID: vg0320174856 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20174856
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 62. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGTACCCACAAGACACAGCCCCACGACACGTTTCCGTGCGCCGACATGCCACCACGACATACCGGAAAGAGGCTGTGACAGGACCCTTTGCATAACCC[C/T]
CTCTAACCAAGCACACCACACCTTAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTTCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGC

Reverse complement sequence

GCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGAACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTAAGGTGTGGTGTGCTTGGTTAGAG[G/A]
GGGTTATGCAAAGGGTCCTGTCACAGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCACGGAAACGTGTCGTGGGGCTGTGTCTTGTGGGTACAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 39.50% 0.85% 0.06% NA
All Indica  2759 35.20% 64.30% 0.51% 0.00% NA
All Japonica  1512 97.80% 0.70% 1.32% 0.20% NA
Aus  269 83.30% 16.70% 0.00% 0.00% NA
Indica I  595 46.70% 52.60% 0.67% 0.00% NA
Indica II  465 30.10% 69.70% 0.22% 0.00% NA
Indica III  913 33.50% 66.00% 0.44% 0.00% NA
Indica Intermediate  786 31.40% 67.90% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.60% 0.40% 0.00% NA
Japonica Intermediate  241 90.90% 0.40% 7.47% 1.24% NA
VI/Aromatic  96 91.70% 5.20% 3.12% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320174856 C -> T LOC_Os03g36390.1 upstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0320174856 C -> T LOC_Os03g36370.1 downstream_gene_variant ; 4482.0bp to feature; MODIFIER silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0320174856 C -> T LOC_Os03g36380.1 downstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0320174856 C -> T LOC_Os03g36400.1 downstream_gene_variant ; 2378.0bp to feature; MODIFIER silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0320174856 C -> T LOC_Os03g36380-LOC_Os03g36390 intergenic_region ; MODIFIER silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0320174856 C -> DEL N N silent_mutation Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320174856 NA 9.31E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856 1.50E-06 NA mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856 1.93E-06 1.46E-08 mr1439 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856 NA 5.04E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320174856 NA 9.48E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251