| Variant ID: vg0320174856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20174856 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, T: 0.29, others allele: 0.00, population size: 62. )
ACTGTACCCACAAGACACAGCCCCACGACACGTTTCCGTGCGCCGACATGCCACCACGACATACCGGAAAGAGGCTGTGACAGGACCCTTTGCATAACCC[C/T]
CTCTAACCAAGCACACCACACCTTAGGTTTCACCCCCACTCCTCGCAAGGCAGCGGGCAGTTCCCTCTCGTGCCTAGGTGAATCCGGAAGCGACAGAGGC
GCCTCTGTCGCTTCCGGATTCACCTAGGCACGAGAGGGAACTGCCCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTAAGGTGTGGTGTGCTTGGTTAGAG[G/A]
GGGTTATGCAAAGGGTCCTGTCACAGCCTCTTTCCGGTATGTCGTGGTGGCATGTCGGCGCACGGAAACGTGTCGTGGGGCTGTGTCTTGTGGGTACAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 39.50% | 0.85% | 0.06% | NA |
| All Indica | 2759 | 35.20% | 64.30% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 97.80% | 0.70% | 1.32% | 0.20% | NA |
| Aus | 269 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.70% | 52.60% | 0.67% | 0.00% | NA |
| Indica II | 465 | 30.10% | 69.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 33.50% | 66.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 31.40% | 67.90% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 0.40% | 7.47% | 1.24% | NA |
| VI/Aromatic | 96 | 91.70% | 5.20% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 34.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320174856 | C -> T | LOC_Os03g36390.1 | upstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0320174856 | C -> T | LOC_Os03g36370.1 | downstream_gene_variant ; 4482.0bp to feature; MODIFIER | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0320174856 | C -> T | LOC_Os03g36380.1 | downstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0320174856 | C -> T | LOC_Os03g36400.1 | downstream_gene_variant ; 2378.0bp to feature; MODIFIER | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0320174856 | C -> T | LOC_Os03g36380-LOC_Os03g36390 | intergenic_region ; MODIFIER | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0320174856 | C -> DEL | N | N | silent_mutation | Average:21.725; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320174856 | NA | 9.31E-06 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320174856 | 1.50E-06 | NA | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320174856 | 1.93E-06 | 1.46E-08 | mr1439 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320174856 | NA | 5.04E-06 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320174856 | NA | 9.48E-08 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |