\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320161270:

Variant ID: vg0320161270 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20161270
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACAAAGCCTACTCCTCGGAGAAACCACCATCTGACACATACTCGTACTCTGGGGGGTTGGGGAAAAAAGAGCAAGACTGAGTACTACCCACTGTACTCA[A/G]
CAAGTCATACCGGAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAAAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGTTGAAAG

Reverse complement sequence

CTTTCAACTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTTTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTCCGGTATGACTTG[T/C]
TGAGTACAGTGGGTAGTACTCAGTCTTGCTCTTTTTTCCCCAACCCCCCAGAGTACGAGTATGTGTCAGATGGTGGTTTCTCCGAGGAGTAGGCTTTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.40% 0.42% 0.34% NA
All Indica  2759 96.30% 3.30% 0.43% 0.00% NA
All Japonica  1512 12.60% 85.90% 0.53% 0.93% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 94.50% 5.00% 0.50% 0.00% NA
Indica II  465 96.10% 3.40% 0.43% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.10% 0.76% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 65.70% 0.20% 0.20% NA
Japonica Intermediate  241 7.50% 84.20% 2.90% 5.39% NA
VI/Aromatic  96 26.00% 71.90% 0.00% 2.08% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320161270 A -> DEL N N silent_mutation Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0320161270 A -> G LOC_Os03g36350.1 upstream_gene_variant ; 2387.0bp to feature; MODIFIER silent_mutation Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0320161270 A -> G LOC_Os03g36360.1 upstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0320161270 A -> G LOC_Os03g36370.1 upstream_gene_variant ; 4852.0bp to feature; MODIFIER silent_mutation Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N
vg0320161270 A -> G LOC_Os03g36360-LOC_Os03g36370 intergenic_region ; MODIFIER silent_mutation Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320161270 NA 2.75E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 2.05E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 6.78E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 2.04E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 1.19E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 3.71E-14 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 6.35E-07 6.35E-07 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 1.01E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270 NA 4.79E-17 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251