\
| Variant ID: vg0320161270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20161270 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACAAAGCCTACTCCTCGGAGAAACCACCATCTGACACATACTCGTACTCTGGGGGGTTGGGGAAAAAAGAGCAAGACTGAGTACTACCCACTGTACTCA[A/G]
CAAGTCATACCGGAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAAAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGTTGAAAG
CTTTCAACTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTTTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTCCGGTATGACTTG[T/C]
TGAGTACAGTGGGTAGTACTCAGTCTTGCTCTTTTTTCCCCAACCCCCCAGAGTACGAGTATGTGTCAGATGGTGGTTTCTCCGAGGAGTAGGCTTTGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 32.40% | 0.42% | 0.34% | NA |
| All Indica | 2759 | 96.30% | 3.30% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 12.60% | 85.90% | 0.53% | 0.93% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.90% | 65.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 84.20% | 2.90% | 5.39% | NA |
| VI/Aromatic | 96 | 26.00% | 71.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320161270 | A -> DEL | N | N | silent_mutation | Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0320161270 | A -> G | LOC_Os03g36350.1 | upstream_gene_variant ; 2387.0bp to feature; MODIFIER | silent_mutation | Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0320161270 | A -> G | LOC_Os03g36360.1 | upstream_gene_variant ; 827.0bp to feature; MODIFIER | silent_mutation | Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0320161270 | A -> G | LOC_Os03g36370.1 | upstream_gene_variant ; 4852.0bp to feature; MODIFIER | silent_mutation | Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0320161270 | A -> G | LOC_Os03g36360-LOC_Os03g36370 | intergenic_region ; MODIFIER | silent_mutation | Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320161270 | NA | 2.75E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 2.05E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 6.78E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 2.04E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 1.19E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 3.71E-14 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | 6.35E-07 | 6.35E-07 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 1.01E-10 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320161270 | NA | 4.79E-17 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |