Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320161270:

Variant ID: vg0320161270 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20161270
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACAAAGCCTACTCCTCGGAGAAACCACCATCTGACACATACTCGTACTCTGGGGGGTTGGGGAAAAAAGAGCAAGACTGAGTACTACCCACTGTACTCA[A/G]
CAAGTCATACCGGAATAGGGGTATGATGCAGGGAATTATCAAAGGAGAGCTAAAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGAAGTTGAAAG

Reverse complement sequence

CTTTCAACTTCTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTTTAGCTCTCCTTTGATAATTCCCTGCATCATACCCCTATTCCGGTATGACTTG[T/C]
TGAGTACAGTGGGTAGTACTCAGTCTTGCTCTTTTTTCCCCAACCCCCCAGAGTACGAGTATGTGTCAGATGGTGGTTTCTCCGAGGAGTAGGCTTTGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	32.40%	0.42%	0.34%	NA
All Indica	2759	96.30%	3.30%	0.43%	0.00%	NA
All Japonica	1512	12.60%	85.90%	0.53%	0.93%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	94.50%	5.00%	0.50%	0.00%	NA
Indica II	465	96.10%	3.40%	0.43%	0.00%	NA
Indica III	913	98.60%	1.30%	0.11%	0.00%	NA
Indica Intermediate	786	95.20%	4.10%	0.76%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	33.90%	65.70%	0.20%	0.20%	NA
Japonica Intermediate	241	7.50%	84.20%	2.90%	5.39%	NA
VI/Aromatic	96	26.00%	71.90%	0.00%	2.08%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320161270	A -> DEL	N	N	silent_mutation	Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0320161270	A -> G	LOC_Os03g36350.1	upstream_gene_variant ; 2387.0bp to feature; MODIFIER	silent_mutation	Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0320161270	A -> G	LOC_Os03g36360.1	upstream_gene_variant ; 827.0bp to feature; MODIFIER	silent_mutation	Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0320161270	A -> G	LOC_Os03g36370.1	upstream_gene_variant ; 4852.0bp to feature; MODIFIER	silent_mutation	Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0320161270	A -> G	LOC_Os03g36360-LOC_Os03g36370	intergenic_region ; MODIFIER	silent_mutation	Average:32.621; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320161270	NA	2.75E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	2.05E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	6.78E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	2.04E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	1.19E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	3.71E-14	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	6.35E-07	6.35E-07	mr1987	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	1.01E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320161270	NA	4.79E-17	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251