Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320153257:

Variant ID: vg0320153257 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20153257
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGTCATGGGTCGGGCGATCCTGGAGAAGTTTTCGATGAATCGGCGATAATAACCCGCAAGTCCAAGAAAACTCCAAATTTGCGACACAGTCTTAGGTG[C/G]
GGTCCACTTGGTAACTGACTCCACATTCGATGGATCAACTGCCACGCCCTGAGCTGTAATAACGTGTAGACCCCTGTTTTTTATAACAGGAATCAATCAT

Reverse complement sequence

ATGATTGATTCCTGTTATAAAAAACAGGGGTCTACACGTTATTACAGCTCAGGGCGTGGCAGTTGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACC[G/C]
CACCTAAGACTGTGTCGCAAATTTGGAGTTTTCTTGGACTTGCGGGTTATTATCGCCGATTCATCGAAAACTTCTCCAGGATCGCCCGACCCATGACTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	32.10%	4.40%	1.14%	NA
All Indica	2759	89.30%	3.50%	7.00%	0.25%	NA
All Japonica	1512	11.80%	84.50%	0.66%	2.98%	NA
Aus	269	89.60%	10.00%	0.37%	0.00%	NA
Indica I	595	70.30%	5.20%	24.03%	0.50%	NA
Indica II	465	94.80%	3.40%	1.51%	0.22%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	89.40%	4.80%	5.34%	0.38%	NA
Temperate Japonica	767	0.10%	97.40%	1.17%	1.30%	NA
Tropical Japonica	504	31.70%	65.50%	0.20%	2.58%	NA
Japonica Intermediate	241	7.50%	83.40%	0.00%	9.13%	NA
VI/Aromatic	96	24.00%	72.90%	1.04%	2.08%	NA
Intermediate	90	46.70%	50.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320153257	C -> DEL	LOC_Os03g36330.1	N	frameshift_variant	Average:28.086; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg0320153257	C -> G	LOC_Os03g36330.1	missense_variant ; p.Ala47Pro; MODERATE	nonsynonymous_codon ; A47P	Average:28.086; most accessible tissue: Minghui63 flag leaf, score: 56.489	benign	-0.42	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320153257	NA	6.39E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	4.94E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	7.62E-07	6.05E-11	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	1.40E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	3.69E-06	NA	mr1672	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	1.22E-09	2.33E-14	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	2.74E-06	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	3.19E-12	3.73E-24	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	4.94E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	9.91E-08	9.91E-08	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	3.02E-23	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	2.76E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	2.86E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	3.86E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	2.51E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	6.18E-07	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	9.74E-09	9.86E-18	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	3.91E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	6.84E-22	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	3.86E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	2.76E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	1.28E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	7.24E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	1.87E-06	4.62E-08	mr1805_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	2.25E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257	NA	1.39E-15	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251