\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320153257:

Variant ID: vg0320153257 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20153257
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTCATGGGTCGGGCGATCCTGGAGAAGTTTTCGATGAATCGGCGATAATAACCCGCAAGTCCAAGAAAACTCCAAATTTGCGACACAGTCTTAGGTG[C/G]
GGTCCACTTGGTAACTGACTCCACATTCGATGGATCAACTGCCACGCCCTGAGCTGTAATAACGTGTAGACCCCTGTTTTTTATAACAGGAATCAATCAT

Reverse complement sequence

ATGATTGATTCCTGTTATAAAAAACAGGGGTCTACACGTTATTACAGCTCAGGGCGTGGCAGTTGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACC[G/C]
CACCTAAGACTGTGTCGCAAATTTGGAGTTTTCTTGGACTTGCGGGTTATTATCGCCGATTCATCGAAAACTTCTCCAGGATCGCCCGACCCATGACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 32.10% 4.40% 1.14% NA
All Indica  2759 89.30% 3.50% 7.00% 0.25% NA
All Japonica  1512 11.80% 84.50% 0.66% 2.98% NA
Aus  269 89.60% 10.00% 0.37% 0.00% NA
Indica I  595 70.30% 5.20% 24.03% 0.50% NA
Indica II  465 94.80% 3.40% 1.51% 0.22% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 89.40% 4.80% 5.34% 0.38% NA
Temperate Japonica  767 0.10% 97.40% 1.17% 1.30% NA
Tropical Japonica  504 31.70% 65.50% 0.20% 2.58% NA
Japonica Intermediate  241 7.50% 83.40% 0.00% 9.13% NA
VI/Aromatic  96 24.00% 72.90% 1.04% 2.08% NA
Intermediate  90 46.70% 50.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320153257 C -> DEL LOC_Os03g36330.1 N frameshift_variant Average:28.086; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0320153257 C -> G LOC_Os03g36330.1 missense_variant ; p.Ala47Pro; MODERATE nonsynonymous_codon ; A47P Average:28.086; most accessible tissue: Minghui63 flag leaf, score: 56.489 benign -0.42 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320153257 NA 6.39E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 4.94E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 7.62E-07 6.05E-11 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 1.40E-19 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 3.69E-06 NA mr1672 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 1.22E-09 2.33E-14 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 2.74E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 3.19E-12 3.73E-24 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 4.94E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 9.91E-08 9.91E-08 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 3.02E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 2.76E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 2.86E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 3.86E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 2.51E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 6.18E-07 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 9.74E-09 9.86E-18 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 3.91E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 6.84E-22 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 3.86E-06 mr1761_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 2.76E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 1.28E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 7.24E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 1.87E-06 4.62E-08 mr1805_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 2.25E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153257 NA 1.39E-15 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251