Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320153246:

Variant ID: vg0320153246 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20153246
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTAAGCAACTGAGTCATGGGTCGGGCGATCCTGGAGAAGTTTTCGATGAATCGGCGATAATAACCCGCAAGTCCAAGAAAACTCCAAATTTGCGACAC[A/G]
GTCTTAGGTGCGGTCCACTTGGTAACTGACTCCACATTCGATGGATCAACTGCCACGCCCTGAGCTGTAATAACGTGTAGACCCCTGTTTTTTATAACAG

Reverse complement sequence

CTGTTATAAAAAACAGGGGTCTACACGTTATTACAGCTCAGGGCGTGGCAGTTGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACCGCACCTAAGAC[T/C]
GTGTCGCAAATTTGGAGTTTTCTTGGACTTGCGGGTTATTATCGCCGATTCATCGAAAACTTCTCCAGGATCGCCCGACCCATGACTCAGTTGCTTAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.20%	32.60%	3.72%	1.48%	NA
All Indica	2759	89.00%	3.50%	6.20%	1.27%	NA
All Japonica	1512	11.90%	85.80%	0.07%	2.18%	NA
Aus	269	89.60%	10.40%	0.00%	0.00%	NA
Indica I	595	69.20%	5.50%	21.68%	3.53%	NA
Indica II	465	94.40%	3.40%	1.94%	0.22%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	89.60%	4.70%	4.07%	1.65%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	31.70%	65.70%	0.20%	2.38%	NA
Japonica Intermediate	241	7.50%	83.80%	0.00%	8.71%	NA
VI/Aromatic	96	24.00%	72.90%	1.04%	2.08%	NA
Intermediate	90	45.60%	51.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320153246	A -> DEL	LOC_Os03g36330.1	N	frameshift_variant	Average:28.215; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0320153246	A -> G	LOC_Os03g36330.1	synonymous_variant ; p.Thr50Thr; LOW	synonymous_codon	Average:28.215; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320153246	NA	6.18E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.73E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	7.06E-07	5.68E-11	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	3.50E-06	NA	mr1672	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	9.56E-10	1.63E-14	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	1.02E-07	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	1.80E-12	1.47E-24	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	9.96E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	6.08E-08	6.08E-08	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.88E-23	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.52E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.32E-14	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.41E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	5.35E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.87E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	6.57E-07	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	8.62E-09	6.68E-18	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.92E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.43E-22	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	4.02E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	5.08E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.72E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	1.73E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	2.27E-06	5.43E-08	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.65E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320153246	NA	2.43E-15	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251