\
| Variant ID: vg0320153204 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20153204 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 89. )
AACTCTTGTCGCACTCAGCTGTCCATTTAAACTTCTCATCTTTCTTAAGCAACTGAGTCATGGGTCGGGCGATCCTGGAGAAGTTTTCGATGAATCGGCG[A/G]
TAATAACCCGCAAGTCCAAGAAAACTCCAAATTTGCGACACAGTCTTAGGTGCGGTCCACTTGGTAACTGACTCCACATTCGATGGATCAACTGCCACGC
GCGTGGCAGTTGATCCATCGAATGTGGAGTCAGTTACCAAGTGGACCGCACCTAAGACTGTGTCGCAAATTTGGAGTTTTCTTGGACTTGCGGGTTATTA[T/C]
CGCCGATTCATCGAAAACTTCTCCAGGATCGCCCGACCCATGACTCAGTTGCTTAAGAAAGATGAGAAGTTTAAATGGACAGCTGAGTGCGACAAGAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 32.60% | 3.53% | 3.05% | NA |
| All Indica | 2759 | 86.60% | 3.60% | 5.94% | 3.91% | NA |
| All Japonica | 1512 | 12.00% | 85.80% | 0.00% | 2.18% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.00% | 5.70% | 20.50% | 11.76% | NA |
| Indica II | 465 | 93.80% | 3.70% | 2.15% | 0.43% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 87.00% | 4.50% | 4.07% | 4.45% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 32.10% | 65.50% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 7.50% | 83.80% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 50.00% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320153204 | A -> DEL | LOC_Os03g36330.1 | N | frameshift_variant | Average:30.298; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| vg0320153204 | A -> G | LOC_Os03g36330.1 | synonymous_variant ; p.Tyr64Tyr; LOW | synonymous_codon | Average:30.298; most accessible tissue: Minghui63 flag leaf, score: 62.47 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320153204 | NA | 9.56E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 8.23E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 2.97E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 1.89E-07 | 3.50E-11 | mr1334 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 6.66E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 2.31E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 8.38E-08 | 1.51E-11 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 3.80E-07 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 1.14E-11 | 1.11E-21 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 4.29E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 3.85E-08 | 3.85E-08 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 1.24E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 1.23E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | 1.69E-07 | 2.64E-13 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 4.87E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 3.62E-18 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 4.47E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320153204 | NA | 2.76E-15 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |