\
| Variant ID: vg0320151239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20151239 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGGAGCTGGAGAAGAGATGCGGATGGGCGGCCTTCAACTCATCTTCCCTTTCCCAGGTTGCCTTTTCCTCTGAATGGTGGCTCCACTGAACCCTGGAGAG[T/C]
CTAGTGACCTTGTTTCTGGTTCTTCTTTCACTGGTCTCAAGGATGCGAACTGGCTTCTCCACGTAGGTCAGATCCTCTTGGATATCGATGTGCTCCGAAT
ATTCGGAGCACATCGATATCCAAGAGGATCTGACCTACGTGGAGAAGCCAGTTCGCATCCTTGAGACCAGTGAAAGAAGAACCAGAAACAAGGTCACTAG[A/G]
CTCTCCAGGGTTCAGTGGAGCCACCATTCAGAGGAAAAGGCAACCTGGGAAAGGGAAGATGAGTTGAAGGCCGCCCATCCGCATCTCTTCTCCAGCTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 37.50% | 2.31% | 2.35% | NA |
| All Indica | 2759 | 84.10% | 11.50% | 2.57% | 1.92% | NA |
| All Japonica | 1512 | 11.70% | 86.70% | 0.20% | 1.39% | NA |
| Aus | 269 | 65.10% | 10.00% | 11.90% | 13.01% | NA |
| Indica I | 595 | 57.50% | 33.30% | 6.72% | 2.52% | NA |
| Indica II | 465 | 93.10% | 5.60% | 0.43% | 0.86% | NA |
| Indica III | 913 | 96.10% | 1.30% | 0.33% | 2.30% | NA |
| Indica Intermediate | 786 | 84.90% | 10.20% | 3.31% | 1.65% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.20% | 68.30% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 7.50% | 83.80% | 0.83% | 7.88% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 52.20% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320151239 | T -> C | LOC_Os03g36330.1 | synonymous_variant ; p.Arg719Arg; LOW | synonymous_codon | Average:25.377; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0320151239 | T -> DEL | LOC_Os03g36330.1 | N | frameshift_variant | Average:25.377; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320151239 | NA | 1.73E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 4.49E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 4.62E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 9.82E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | 7.14E-06 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | 3.62E-09 | 3.45E-18 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 6.70E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | 1.79E-06 | 1.79E-06 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 2.78E-11 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 5.04E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 9.56E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 5.99E-15 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 3.67E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | 3.56E-06 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | 8.36E-11 | 1.76E-23 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320151239 | NA | 1.35E-07 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |