\
| Variant ID: vg0320137682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20137682 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CACCTCACTTTGTGTTTTCTAAAATCGTTGCTTATATATCCTTTGTTCCTTGTTTCTCAATGATGGCTACCCGCATTCACCGTGGTTGTCGAGAGCCCAC[G/A]
CCGGAGCCCGTGAGTGAGCATGAGGAATCGAGCAGACAGGAATATGCTCAAAGCGAGGAAGAATTTGTAGAAGAAGTTGAGGGGGTTGAGGAGGAAGCTA
TAGCTTCCTCCTCAACCCCCTCAACTTCTTCTACAAATTCTTCCTCGCTTTGAGCATATTCCTGTCTGCTCGATTCCTCATGCTCACTCACGGGCTCCGG[C/T]
GTGGGCTCTCGACAACCACGGTGAATGCGGGTAGCCATCATTGAGAAACAAGGAACAAAGGATATATAAGCAACGATTTTAGAAAACACAAAGTGAGGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 32.90% | 0.32% | 5.63% | NA |
| All Indica | 2759 | 87.10% | 3.40% | 0.40% | 9.13% | NA |
| All Japonica | 1512 | 12.00% | 87.20% | 0.00% | 0.79% | NA |
| Aus | 269 | 89.60% | 10.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 62.40% | 6.20% | 1.18% | 30.25% | NA |
| Indica II | 465 | 94.40% | 3.00% | 0.00% | 2.58% | NA |
| Indica III | 913 | 98.70% | 1.10% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 88.00% | 4.10% | 0.38% | 7.51% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.90% | 65.70% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 48.90% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320137682 | G -> A | LOC_Os03g36290.1 | upstream_gene_variant ; 4140.0bp to feature; MODIFIER | silent_mutation | Average:43.426; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| vg0320137682 | G -> A | LOC_Os03g36300.1 | upstream_gene_variant ; 149.0bp to feature; MODIFIER | silent_mutation | Average:43.426; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| vg0320137682 | G -> A | LOC_Os03g36310.1 | upstream_gene_variant ; 374.0bp to feature; MODIFIER | silent_mutation | Average:43.426; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| vg0320137682 | G -> A | LOC_Os03g36300-LOC_Os03g36310 | intergenic_region ; MODIFIER | silent_mutation | Average:43.426; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| vg0320137682 | G -> DEL | N | N | silent_mutation | Average:43.426; most accessible tissue: Zhenshan97 young leaf, score: 78.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320137682 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 5.35E-12 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 7.10E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 1.89E-14 | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | NA | 2.08E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320137682 | 5.33E-08 | 5.01E-12 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |