\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320136332:

Variant ID: vg0320136332 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20136332
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGCTGCTCACGTTGCAACCGGTCTCGCTCTTGCGCTTGTCGCTCCTCTTCCAGTCGGCGACGCTCAGCTTCTTGTCGTGTGCGTTGTTCTTCTACTTC[G/A,C]
CGGGGTTGACGTTGTTCTGCTATCTCATTATCGGCCATGAAAACGCCGAAAAAGAGAGGCGCGTAGTTGTCTTCATAGGCTTCATCAGAATCGTCGAGGT

Reverse complement sequence

ACCTCGACGATTCTGATGAAGCCTATGAAGACAACTACGCGCCTCTCTTTTTCGGCGTTTTCATGGCCGATAATGAGATAGCAGAACAACGTCAACCCCG[C/T,G]
GAAGTAGAAGAACAACGCACACGACAAGAAGCTGAGCGTCGCCGACTGGAAGAGGAGCGACAAGCGCAAGAGCGAGACCGGTTGCAACGTGAGCAGCAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 32.30% 0.23% 5.46% C: 0.02%
All Indica  2759 87.10% 3.40% 0.36% 9.17% C: 0.04%
All Japonica  1512 14.30% 85.70% 0.00% 0.00% NA
Aus  269 90.00% 9.70% 0.00% 0.37% NA
Indica I  595 61.80% 6.70% 1.18% 30.25% NA
Indica II  465 94.00% 3.00% 0.00% 2.80% C: 0.22%
Indica III  913 98.70% 1.10% 0.00% 0.22% NA
Indica Intermediate  786 88.50% 3.70% 0.38% 7.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.50% 65.50% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 50.00% 44.40% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320136332 G -> C LOC_Os03g36300.1 synonymous_variant ; p.Arg87Arg; LOW synonymous_codon Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0320136332 G -> A LOC_Os03g36300.1 synonymous_variant ; p.Arg87Arg; LOW synonymous_codon Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N
vg0320136332 G -> A LOC_Os03g36300.1 synonymous_variant ; p.Arg87Arg; LOW nonsynonymous_codon ; R87C Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 probably damaging 3.187 DELETERIOUS 0.00
vg0320136332 G -> DEL LOC_Os03g36300.1 N frameshift_variant Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320136332 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 2.55E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 6.43E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 1.08E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 2.08E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 5.23E-08 NA mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320136332 NA 3.20E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251