\
| Variant ID: vg0320136332 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20136332 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCTGCTGCTCACGTTGCAACCGGTCTCGCTCTTGCGCTTGTCGCTCCTCTTCCAGTCGGCGACGCTCAGCTTCTTGTCGTGTGCGTTGTTCTTCTACTTC[G/A,C]
CGGGGTTGACGTTGTTCTGCTATCTCATTATCGGCCATGAAAACGCCGAAAAAGAGAGGCGCGTAGTTGTCTTCATAGGCTTCATCAGAATCGTCGAGGT
ACCTCGACGATTCTGATGAAGCCTATGAAGACAACTACGCGCCTCTCTTTTTCGGCGTTTTCATGGCCGATAATGAGATAGCAGAACAACGTCAACCCCG[C/T,G]
GAAGTAGAAGAACAACGCACACGACAAGAAGCTGAGCGTCGCCGACTGGAAGAGGAGCGACAAGCGCAAGAGCGAGACCGGTTGCAACGTGAGCAGCAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 32.30% | 0.23% | 5.46% | C: 0.02% |
| All Indica | 2759 | 87.10% | 3.40% | 0.36% | 9.17% | C: 0.04% |
| All Japonica | 1512 | 14.30% | 85.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 9.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 61.80% | 6.70% | 1.18% | 30.25% | NA |
| Indica II | 465 | 94.00% | 3.00% | 0.00% | 2.80% | C: 0.22% |
| Indica III | 913 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 88.50% | 3.70% | 0.38% | 7.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.50% | 65.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.60% | 83.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 44.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320136332 | G -> C | LOC_Os03g36300.1 | synonymous_variant ; p.Arg87Arg; LOW | synonymous_codon | Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0320136332 | G -> A | LOC_Os03g36300.1 | synonymous_variant ; p.Arg87Arg; LOW | synonymous_codon | Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0320136332 | G -> A | LOC_Os03g36300.1 | synonymous_variant ; p.Arg87Arg; LOW | nonsynonymous_codon ; R87C | Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | probably damaging |
3.187 |
DELETERIOUS | 0.00 |
| vg0320136332 | G -> DEL | LOC_Os03g36300.1 | N | frameshift_variant | Average:44.641; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320136332 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 2.55E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 6.43E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 7.10E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 1.08E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 2.08E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | 5.23E-08 | NA | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320136332 | NA | 3.20E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |