\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320128318:

Variant ID: vg0320128318 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20128318
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGATTCCATTGGACTTTAAACATTCTTATCACTTTGGTGCGAGTTGTTCTTTGTGCTTCATCCAAAATTATGATAGGATATTCTGGATAGGTTAAAT[A/C]
TTTTTCCAGTTTAATAGTGCTTACTGATATTTCTTCTTCTAGAATATGCAAACATTTCTTTAGTTGTGAGACATGGAATATAGGATGTACATCTGATAAG

Reverse complement sequence

CTTATCAGATGTACATCCTATATTCCATGTCTCACAACTAAAGAAATGTTTGCATATTCTAGAAGAAGAAATATCAGTAAGCACTATTAAACTGGAAAAA[T/G]
ATTTAACCTATCCAGAATATCCTATCATAATTTTGGATGAAGCACAAAGAACAACTCGCACCAAAGTGATAAGAATGTTTAAAGTCCAATGGAATCACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 36.20% 0.78% 5.40% NA
All Indica  2759 80.40% 10.10% 1.30% 8.23% NA
All Japonica  1512 12.80% 85.60% 0.00% 1.52% NA
Aus  269 90.00% 9.70% 0.37% 0.00% NA
Indica I  595 58.20% 10.60% 2.35% 28.91% NA
Indica II  465 80.00% 17.40% 1.08% 1.51% NA
Indica III  913 95.80% 4.10% 0.00% 0.11% NA
Indica Intermediate  786 79.50% 12.30% 2.16% 5.98% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.90% 83.00% 0.00% 9.13% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 48.90% 48.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320128318 A -> C LOC_Os03g36279.1 upstream_gene_variant ; 3066.0bp to feature; MODIFIER silent_mutation Average:35.777; most accessible tissue: Callus, score: 74.156 N N N N
vg0320128318 A -> C LOC_Os03g36270.1 downstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:35.777; most accessible tissue: Callus, score: 74.156 N N N N
vg0320128318 A -> C LOC_Os03g36290.1 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:35.777; most accessible tissue: Callus, score: 74.156 N N N N
vg0320128318 A -> C LOC_Os03g36279-LOC_Os03g36290 intergenic_region ; MODIFIER silent_mutation Average:35.777; most accessible tissue: Callus, score: 74.156 N N N N
vg0320128318 A -> DEL N N silent_mutation Average:35.777; most accessible tissue: Callus, score: 74.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320128318 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 7.50E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 6.45E-23 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 1.84E-06 5.67E-07 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 2.79E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.16E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.63E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 3.93E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 6.63E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 2.08E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.45E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.79E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318 NA 1.61E-12 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251