\
| Variant ID: vg0320128318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20128318 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 57. )
TGGTGATTCCATTGGACTTTAAACATTCTTATCACTTTGGTGCGAGTTGTTCTTTGTGCTTCATCCAAAATTATGATAGGATATTCTGGATAGGTTAAAT[A/C]
TTTTTCCAGTTTAATAGTGCTTACTGATATTTCTTCTTCTAGAATATGCAAACATTTCTTTAGTTGTGAGACATGGAATATAGGATGTACATCTGATAAG
CTTATCAGATGTACATCCTATATTCCATGTCTCACAACTAAAGAAATGTTTGCATATTCTAGAAGAAGAAATATCAGTAAGCACTATTAAACTGGAAAAA[T/G]
ATTTAACCTATCCAGAATATCCTATCATAATTTTGGATGAAGCACAAAGAACAACTCGCACCAAAGTGATAAGAATGTTTAAAGTCCAATGGAATCACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 36.20% | 0.78% | 5.40% | NA |
| All Indica | 2759 | 80.40% | 10.10% | 1.30% | 8.23% | NA |
| All Japonica | 1512 | 12.80% | 85.60% | 0.00% | 1.52% | NA |
| Aus | 269 | 90.00% | 9.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 58.20% | 10.60% | 2.35% | 28.91% | NA |
| Indica II | 465 | 80.00% | 17.40% | 1.08% | 1.51% | NA |
| Indica III | 913 | 95.80% | 4.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 79.50% | 12.30% | 2.16% | 5.98% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.90% | 83.00% | 0.00% | 9.13% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320128318 | A -> C | LOC_Os03g36279.1 | upstream_gene_variant ; 3066.0bp to feature; MODIFIER | silent_mutation | Average:35.777; most accessible tissue: Callus, score: 74.156 | N | N | N | N |
| vg0320128318 | A -> C | LOC_Os03g36270.1 | downstream_gene_variant ; 4871.0bp to feature; MODIFIER | silent_mutation | Average:35.777; most accessible tissue: Callus, score: 74.156 | N | N | N | N |
| vg0320128318 | A -> C | LOC_Os03g36290.1 | downstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:35.777; most accessible tissue: Callus, score: 74.156 | N | N | N | N |
| vg0320128318 | A -> C | LOC_Os03g36279-LOC_Os03g36290 | intergenic_region ; MODIFIER | silent_mutation | Average:35.777; most accessible tissue: Callus, score: 74.156 | N | N | N | N |
| vg0320128318 | A -> DEL | N | N | silent_mutation | Average:35.777; most accessible tissue: Callus, score: 74.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320128318 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 7.50E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 6.45E-23 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | 1.84E-06 | 5.67E-07 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 2.79E-07 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.16E-09 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.63E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 3.93E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 7.10E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 6.63E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 2.08E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.45E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.79E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320128318 | NA | 1.61E-12 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |