Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0320128318:

Variant ID: vg0320128318 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 20128318
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGATTCCATTGGACTTTAAACATTCTTATCACTTTGGTGCGAGTTGTTCTTTGTGCTTCATCCAAAATTATGATAGGATATTCTGGATAGGTTAAAT[A/C]
TTTTTCCAGTTTAATAGTGCTTACTGATATTTCTTCTTCTAGAATATGCAAACATTTCTTTAGTTGTGAGACATGGAATATAGGATGTACATCTGATAAG

Reverse complement sequence

CTTATCAGATGTACATCCTATATTCCATGTCTCACAACTAAAGAAATGTTTGCATATTCTAGAAGAAGAAATATCAGTAAGCACTATTAAACTGGAAAAA[T/G]
ATTTAACCTATCCAGAATATCCTATCATAATTTTGGATGAAGCACAAAGAACAACTCGCACCAAAGTGATAAGAATGTTTAAAGTCCAATGGAATCACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	36.20%	0.78%	5.40%	NA
All Indica	2759	80.40%	10.10%	1.30%	8.23%	NA
All Japonica	1512	12.80%	85.60%	0.00%	1.52%	NA
Aus	269	90.00%	9.70%	0.37%	0.00%	NA
Indica I	595	58.20%	10.60%	2.35%	28.91%	NA
Indica II	465	80.00%	17.40%	1.08%	1.51%	NA
Indica III	913	95.80%	4.10%	0.00%	0.11%	NA
Indica Intermediate	786	79.50%	12.30%	2.16%	5.98%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.90%	83.00%	0.00%	9.13%	NA
VI/Aromatic	96	25.00%	71.90%	0.00%	3.12%	NA
Intermediate	90	48.90%	48.90%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0320128318	A -> C	LOC_Os03g36279.1	upstream_gene_variant ; 3066.0bp to feature; MODIFIER	silent_mutation	Average:35.777; most accessible tissue: Callus, score: 74.156	N	N	N	N
vg0320128318	A -> C	LOC_Os03g36270.1	downstream_gene_variant ; 4871.0bp to feature; MODIFIER	silent_mutation	Average:35.777; most accessible tissue: Callus, score: 74.156	N	N	N	N
vg0320128318	A -> C	LOC_Os03g36290.1	downstream_gene_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:35.777; most accessible tissue: Callus, score: 74.156	N	N	N	N
vg0320128318	A -> C	LOC_Os03g36279-LOC_Os03g36290	intergenic_region ; MODIFIER	silent_mutation	Average:35.777; most accessible tissue: Callus, score: 74.156	N	N	N	N
vg0320128318	A -> DEL	N	N	silent_mutation	Average:35.777; most accessible tissue: Callus, score: 74.156	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0320128318	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	7.50E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	6.45E-23	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	1.84E-06	5.67E-07	mr1588	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	2.79E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.16E-09	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.63E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	3.93E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	7.10E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	6.63E-09	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	2.08E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.45E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.79E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320128318	NA	1.61E-12	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251