\
| Variant ID: vg0320115825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20115825 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.02, others allele: 0.00, population size: 63. )
GGGAGAGGCAGAGATGGAGCTCGGCGTTTTTAGGGCGTCGACACGTCGTGGCCACGCGTCGCGCAGCGTCCAGAGCCGGTCGGCGCTCGATCTCTCCCTC[T/C]
CAGTGTTTCTCAGTCGGCTAGGGAAGTTGCACACAGGAAGGGCAAACCGGAGGGATTGACAAGGGGGCCCAGGTCGAAGTAAACTAGGTGGAAGAGAGAT
ATCTCTCTTCCACCTAGTTTACTTCGACCTGGGCCCCCTTGTCAATCCCTCCGGTTTGCCCTTCCTGTGTGCAACTTCCCTAGCCGACTGAGAAACACTG[A/G]
GAGGGAGAGATCGAGCGCCGACCGGCTCTGGACGCTGCGCGACGCGTGGCCACGACGTGTCGACGCCCTAAAAACGCCGAGCTCCATCTCTGCCTCTCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.60% | 11.30% | 1.33% | 2.81% | NA |
| All Indica | 2759 | 80.60% | 13.00% | 2.21% | 4.13% | NA |
| All Japonica | 1512 | 87.60% | 11.10% | 0.07% | 1.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 4.00% | 0.84% | 0.67% | NA |
| Indica II | 465 | 76.60% | 17.20% | 2.58% | 3.66% | NA |
| Indica III | 913 | 70.30% | 18.40% | 3.83% | 7.45% | NA |
| Indica Intermediate | 786 | 84.50% | 11.20% | 1.15% | 3.18% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.40% | 30.20% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 86.30% | 6.60% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320115825 | T -> C | LOC_Os03g36270.1 | upstream_gene_variant ; 4658.0bp to feature; MODIFIER | silent_mutation | Average:43.289; most accessible tissue: Callus, score: 96.655 | N | N | N | N |
| vg0320115825 | T -> C | LOC_Os03g36260.1 | downstream_gene_variant ; 4833.0bp to feature; MODIFIER | silent_mutation | Average:43.289; most accessible tissue: Callus, score: 96.655 | N | N | N | N |
| vg0320115825 | T -> C | LOC_Os03g36260-LOC_Os03g36270 | intergenic_region ; MODIFIER | silent_mutation | Average:43.289; most accessible tissue: Callus, score: 96.655 | N | N | N | N |
| vg0320115825 | T -> DEL | N | N | silent_mutation | Average:43.289; most accessible tissue: Callus, score: 96.655 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320115825 | NA | 1.93E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | 3.13E-10 | 2.46E-11 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | 3.09E-07 | 5.48E-09 | mr1439 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | NA | 4.32E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | NA | 1.40E-07 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | NA | 9.33E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | NA | 5.80E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320115825 | NA | 1.48E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |