| Variant ID: vg0320046714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20046714 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAAAGGCCCATGACTGGTGATGCAACACCTTGTTTCTTCATTTGTGGACGACTGGGATGGAATTTGGAGTTGAGGCCGGATCCGCTGGAAAGAGGACTCC[A/G]
AGAGCTTTCCACCAAGTACTCACGGGTCAAAAACGGAGGTTGTATGCAGATTCGGCGGCTGATTGAATTCAGCAATGTAGTAGGTGGCCGAATCGGATTC
GAATCCGATTCGGCCACCTACTACATTGCTGAATTCAATCAGCCGCCGAATCTGCATACAACCTCCGTTTTTGACCCGTGAGTACTTGGTGGAAAGCTCT[T/C]
GGAGTCCTCTTTCCAGCGGATCCGGCCTCAACTCCAAATTCCATCCCAGTCGTCCACAAATGAAGAAACAAGGTGTTGCATCACCAGTCATGGGCCTTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 10.00% | 9.73% | 47.44% | NA |
| All Indica | 2759 | 3.70% | 16.70% | 15.30% | 64.23% | NA |
| All Japonica | 1512 | 86.20% | 0.00% | 0.26% | 13.56% | NA |
| Aus | 269 | 10.40% | 3.30% | 9.67% | 76.58% | NA |
| Indica I | 595 | 3.40% | 16.30% | 11.76% | 68.57% | NA |
| Indica II | 465 | 4.50% | 7.70% | 10.11% | 77.63% | NA |
| Indica III | 913 | 2.30% | 22.30% | 21.14% | 54.22% | NA |
| Indica Intermediate | 786 | 5.20% | 15.90% | 14.25% | 64.63% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 66.70% | 0.00% | 0.60% | 32.74% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.00% | 0.41% | 15.35% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 1.04% | 26.04% | NA |
| Intermediate | 90 | 51.10% | 3.30% | 7.78% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320046714 | A -> DEL | N | N | silent_mutation | Average:11.51; most accessible tissue: Callus, score: 34.336 | N | N | N | N |
| vg0320046714 | A -> G | LOC_Os03g36130.1 | 5_prime_UTR_variant ; 1997.0bp to feature; MODIFIER | silent_mutation | Average:11.51; most accessible tissue: Callus, score: 34.336 | N | N | N | N |
| vg0320046714 | A -> G | LOC_Os03g36140.1 | downstream_gene_variant ; 2525.0bp to feature; MODIFIER | silent_mutation | Average:11.51; most accessible tissue: Callus, score: 34.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320046714 | NA | 2.31E-07 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | 1.93E-06 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | 1.63E-07 | 4.02E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | 6.79E-07 | 6.79E-07 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | NA | 1.24E-06 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | NA | 2.93E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320046714 | NA | 4.49E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |