\
| Variant ID: vg0320043666 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 20043666 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )
CTAAGCAACTAATTTCTCCTCCAAATTATTGAGCTCACAAAAATCATCAAATTGAACATAGCTAAAAGTATTTAAAGAAGTTATCAATTTACGTTCCTCA[A/G]
CATCATTAGCAATGTGAACATCATGCTTAAAATCAGCACACAATGAAACACTAGAAATAGCATGTTCATTCACTAGTTGTGGTAGGGATATAAGTGAAGC
GCTTCACTTATATCCCTACCACAACTAGTGAATGAACATGCTATTTCTAGTGTTTCATTGTGTGCTGATTTTAAGCATGATGTTCACATTGCTAATGATG[T/C]
TGAGGAACGTAAATTGATAACTTCTTTAAATACTTTTAGCTATGTTCAATTTGATGATTTTTGTGAGCTCAATAATTTGGAGGAGAAATTAGTTGCTTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 12.90% | 4.72% | 30.24% | NA |
| All Indica | 2759 | 36.10% | 20.80% | 7.29% | 35.81% | NA |
| All Japonica | 1512 | 86.10% | 0.00% | 0.20% | 13.69% | NA |
| Aus | 269 | 12.60% | 13.80% | 3.72% | 69.89% | NA |
| Indica I | 595 | 58.20% | 16.00% | 10.92% | 14.96% | NA |
| Indica II | 465 | 36.60% | 2.60% | 4.73% | 56.13% | NA |
| Indica III | 913 | 18.90% | 38.20% | 5.37% | 37.46% | NA |
| Indica Intermediate | 786 | 39.20% | 14.90% | 8.27% | 37.66% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 66.30% | 0.00% | 0.40% | 33.33% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.00% | 0.00% | 15.35% | NA |
| VI/Aromatic | 96 | 71.90% | 0.00% | 4.17% | 23.96% | NA |
| Intermediate | 90 | 66.70% | 2.20% | 5.56% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0320043666 | A -> DEL | LOC_Os03g36130.1 | N | frameshift_variant | Average:9.414; most accessible tissue: Callus, score: 21.868 | N | N | N | N |
| vg0320043666 | A -> G | LOC_Os03g36130.1 | missense_variant ; p.Val164Ala; MODERATE | nonsynonymous_codon ; V164A | Average:9.414; most accessible tissue: Callus, score: 21.868 | benign |
1.226 |
DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0320043666 | NA | 1.09E-06 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 1.84E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 2.10E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 4.04E-08 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 1.62E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 9.70E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 7.06E-06 | 1.18E-06 | mr1421_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 5.45E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 9.01E-06 | NA | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 7.54E-08 | NA | mr1519_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 1.85E-09 | 5.10E-18 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 5.37E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 6.20E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 4.75E-06 | 4.74E-06 | mr1752_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 2.04E-07 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 6.14E-07 | NA | mr1874_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 1.44E-07 | mr1874_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | NA | 1.89E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0320043666 | 1.50E-06 | 1.49E-06 | mr1953_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |