\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0320043666:

Variant ID: vg0320043666 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 20043666
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAGCAACTAATTTCTCCTCCAAATTATTGAGCTCACAAAAATCATCAAATTGAACATAGCTAAAAGTATTTAAAGAAGTTATCAATTTACGTTCCTCA[A/G]
CATCATTAGCAATGTGAACATCATGCTTAAAATCAGCACACAATGAAACACTAGAAATAGCATGTTCATTCACTAGTTGTGGTAGGGATATAAGTGAAGC

Reverse complement sequence

GCTTCACTTATATCCCTACCACAACTAGTGAATGAACATGCTATTTCTAGTGTTTCATTGTGTGCTGATTTTAAGCATGATGTTCACATTGCTAATGATG[T/C]
TGAGGAACGTAAATTGATAACTTCTTTAAATACTTTTAGCTATGTTCAATTTGATGATTTTTGTGAGCTCAATAATTTGGAGGAGAAATTAGTTGCTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 12.90% 4.72% 30.24% NA
All Indica  2759 36.10% 20.80% 7.29% 35.81% NA
All Japonica  1512 86.10% 0.00% 0.20% 13.69% NA
Aus  269 12.60% 13.80% 3.72% 69.89% NA
Indica I  595 58.20% 16.00% 10.92% 14.96% NA
Indica II  465 36.60% 2.60% 4.73% 56.13% NA
Indica III  913 18.90% 38.20% 5.37% 37.46% NA
Indica Intermediate  786 39.20% 14.90% 8.27% 37.66% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 66.30% 0.00% 0.40% 33.33% NA
Japonica Intermediate  241 84.60% 0.00% 0.00% 15.35% NA
VI/Aromatic  96 71.90% 0.00% 4.17% 23.96% NA
Intermediate  90 66.70% 2.20% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0320043666 A -> DEL LOC_Os03g36130.1 N frameshift_variant Average:9.414; most accessible tissue: Callus, score: 21.868 N N N N
vg0320043666 A -> G LOC_Os03g36130.1 missense_variant ; p.Val164Ala; MODERATE nonsynonymous_codon ; V164A Average:9.414; most accessible tissue: Callus, score: 21.868 benign 1.226 DELETERIOUS 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0320043666 NA 1.09E-06 mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 1.84E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 2.10E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 4.04E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 1.62E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 9.70E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 7.06E-06 1.18E-06 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 5.45E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 9.01E-06 NA mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 7.54E-08 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 1.85E-09 5.10E-18 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 5.37E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 6.20E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 4.75E-06 4.74E-06 mr1752_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 2.04E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 6.14E-07 NA mr1874_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 1.44E-07 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 NA 1.89E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0320043666 1.50E-06 1.49E-06 mr1953_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251