\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319922800:

Variant ID: vg0319922800 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19922800
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATTCCAATTATTAAAAGTACTGTTAACTGGGGTTTTCTCCTGGTTAACCAAAGCAAATTCTTGAGATCATTTATTAGTGATTTGGAACCTAAGGGAA[G/C,T]
GGAAAACTCCGGGTGTGACAGGGTCGTTCGACATCATCGACACCTCGTCACACAAAGCTATCACACTTCGTGACGACTTAGATAATTTGTTCAAGGTAAA

Reverse complement sequence

TTTACCTTGAACAAATTATCTAAGTCGTCACGAAGTGTGATAGCTTTGTGTGACGAGGTGTCGATGATGTCGAACGACCCTGTCACACCCGGAGTTTTCC[C/G,A]
TTCCCTTAGGTTCCAAATCACTAATAAATGATCTCAAGAATTTGCTTTGGTTAACCAGGAGAAAACCCCAGTTAACAGTACTTTTAATAATTGGAATTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 19.30% 3.41% 0.00% NA
All Indica  2759 62.20% 32.20% 5.58% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 73.40% 14.30% 12.27% 0.00% NA
Indica II  465 91.60% 5.80% 2.58% 0.00% NA
Indica III  913 44.50% 54.20% 1.31% 0.00% NA
Indica Intermediate  786 56.90% 35.90% 7.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 15.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319922800 G -> C LOC_Os03g35910.1 upstream_gene_variant ; 2681.0bp to feature; MODIFIER silent_mutation Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N
vg0319922800 G -> C LOC_Os03g35920.1 downstream_gene_variant ; 2817.0bp to feature; MODIFIER silent_mutation Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N
vg0319922800 G -> C LOC_Os03g35910-LOC_Os03g35920 intergenic_region ; MODIFIER silent_mutation Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N
vg0319922800 G -> T LOC_Os03g35910.1 upstream_gene_variant ; 2681.0bp to feature; MODIFIER N Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N
vg0319922800 G -> T LOC_Os03g35920.1 downstream_gene_variant ; 2817.0bp to feature; MODIFIER N Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N
vg0319922800 G -> T LOC_Os03g35910-LOC_Os03g35920 intergenic_region ; MODIFIER N Average:40.024; most accessible tissue: Callus, score: 61.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319922800 NA 2.15E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 9.01E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 1.22E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 8.92E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 1.53E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 6.66E-06 mr1214 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 1.62E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 7.03E-06 NA mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 2.18E-10 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 6.98E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 2.87E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 2.21E-06 9.06E-06 mr1901 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 9.68E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 2.53E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 2.06E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 5.00E-09 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 9.38E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 9.79E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 3.42E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 2.18E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 1.03E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800 NA 7.62E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251