\
| Variant ID: vg0319922800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19922800 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
ACAATTCCAATTATTAAAAGTACTGTTAACTGGGGTTTTCTCCTGGTTAACCAAAGCAAATTCTTGAGATCATTTATTAGTGATTTGGAACCTAAGGGAA[G/C,T]
GGAAAACTCCGGGTGTGACAGGGTCGTTCGACATCATCGACACCTCGTCACACAAAGCTATCACACTTCGTGACGACTTAGATAATTTGTTCAAGGTAAA
TTTACCTTGAACAAATTATCTAAGTCGTCACGAAGTGTGATAGCTTTGTGTGACGAGGTGTCGATGATGTCGAACGACCCTGTCACACCCGGAGTTTTCC[C/G,A]
TTCCCTTAGGTTCCAAATCACTAATAAATGATCTCAAGAATTTGCTTTGGTTAACCAGGAGAAAACCCCAGTTAACAGTACTTTTAATAATTGGAATTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 19.30% | 3.41% | 0.00% | NA |
| All Indica | 2759 | 62.20% | 32.20% | 5.58% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 73.40% | 14.30% | 12.27% | 0.00% | NA |
| Indica II | 465 | 91.60% | 5.80% | 2.58% | 0.00% | NA |
| Indica III | 913 | 44.50% | 54.20% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 56.90% | 35.90% | 7.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 15.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319922800 | G -> C | LOC_Os03g35910.1 | upstream_gene_variant ; 2681.0bp to feature; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| vg0319922800 | G -> C | LOC_Os03g35920.1 | downstream_gene_variant ; 2817.0bp to feature; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| vg0319922800 | G -> C | LOC_Os03g35910-LOC_Os03g35920 | intergenic_region ; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| vg0319922800 | G -> T | LOC_Os03g35910.1 | upstream_gene_variant ; 2681.0bp to feature; MODIFIER | N | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| vg0319922800 | G -> T | LOC_Os03g35920.1 | downstream_gene_variant ; 2817.0bp to feature; MODIFIER | N | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| vg0319922800 | G -> T | LOC_Os03g35910-LOC_Os03g35920 | intergenic_region ; MODIFIER | N | Average:40.024; most accessible tissue: Callus, score: 61.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319922800 | NA | 2.15E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 9.01E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 1.22E-06 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 8.92E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 1.53E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 6.66E-06 | mr1214 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 1.62E-06 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | 7.03E-06 | NA | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 2.18E-10 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 6.98E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 2.87E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | 2.21E-06 | 9.06E-06 | mr1901 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 9.68E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 2.53E-08 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 2.06E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 5.00E-09 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 9.38E-09 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 9.79E-08 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 3.42E-09 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 2.18E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 1.03E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319922800 | NA | 7.62E-09 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |