Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319922800:

Variant ID: vg0319922800 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19922800
Reference Allele: G	Alternative Allele: C,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATTCCAATTATTAAAAGTACTGTTAACTGGGGTTTTCTCCTGGTTAACCAAAGCAAATTCTTGAGATCATTTATTAGTGATTTGGAACCTAAGGGAA[G/C,T]
GGAAAACTCCGGGTGTGACAGGGTCGTTCGACATCATCGACACCTCGTCACACAAAGCTATCACACTTCGTGACGACTTAGATAATTTGTTCAAGGTAAA

Reverse complement sequence

TTTACCTTGAACAAATTATCTAAGTCGTCACGAAGTGTGATAGCTTTGTGTGACGAGGTGTCGATGATGTCGAACGACCCTGTCACACCCGGAGTTTTCC[C/G,A]
TTCCCTTAGGTTCCAAATCACTAATAAATGATCTCAAGAATTTGCTTTGGTTAACCAGGAGAAAACCCCAGTTAACAGTACTTTTAATAATTGGAATTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	19.30%	3.41%	0.00%	NA
All Indica	2759	62.20%	32.20%	5.58%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	73.40%	14.30%	12.27%	0.00%	NA
Indica II	465	91.60%	5.80%	2.58%	0.00%	NA
Indica III	913	44.50%	54.20%	1.31%	0.00%	NA
Indica Intermediate	786	56.90%	35.90%	7.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	15.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319922800	G -> C	LOC_Os03g35910.1	upstream_gene_variant ; 2681.0bp to feature; MODIFIER	silent_mutation	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N
vg0319922800	G -> C	LOC_Os03g35920.1	downstream_gene_variant ; 2817.0bp to feature; MODIFIER	silent_mutation	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N
vg0319922800	G -> C	LOC_Os03g35910-LOC_Os03g35920	intergenic_region ; MODIFIER	silent_mutation	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N
vg0319922800	G -> T	LOC_Os03g35910.1	upstream_gene_variant ; 2681.0bp to feature; MODIFIER	N	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N
vg0319922800	G -> T	LOC_Os03g35920.1	downstream_gene_variant ; 2817.0bp to feature; MODIFIER	N	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N
vg0319922800	G -> T	LOC_Os03g35910-LOC_Os03g35920	intergenic_region ; MODIFIER	N	Average:40.024; most accessible tissue: Callus, score: 61.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319922800	NA	2.15E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	9.01E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	1.22E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	8.92E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	1.53E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	6.66E-06	mr1214	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	1.62E-06	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	7.03E-06	NA	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	2.18E-10	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	6.98E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	2.87E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	2.21E-06	9.06E-06	mr1901	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	9.68E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	2.53E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	2.06E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	5.00E-09	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	9.38E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	9.79E-08	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	3.42E-09	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	2.18E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	1.03E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319922800	NA	7.62E-09	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251