\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319913239:

Variant ID: vg0319913239 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19913239
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCCCGTAATGAACCATGCTATACAAAAGATAAAGCCGTTGCCCACGCTGGCTTGTGGTTGGTACGGTTAATGTTTCACAACAGTAGCTCGCGAACCG[A/G]
TCCTTAATTGTCATGAGCACGAACTTCAAAACCATGTGCTCACAACCCACCATTGACAAGTTTTAATTATCAATTAATTATCATAACACGATTAACCATC

Reverse complement sequence

GATGGTTAATCGTGTTATGATAATTAATTGATAATTAAAACTTGTCAATGGTGGGTTGTGAGCACATGGTTTTGAAGTTCGTGCTCATGACAATTAAGGA[T/C]
CGGTTCGCGAGCTACTGTTGTGAAACATTAACCGTACCAACCACAAGCCAGCGTGGGCAACGGCTTTATCTTTTGTATAGCATGGTTCATTACGGGGTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 31.50% 0.66% 0.34% NA
All Indica  2759 97.20% 2.50% 0.25% 0.00% NA
All Japonica  1512 13.00% 84.70% 1.26% 1.06% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 97.50% 2.20% 0.34% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.20% 0.64% 0.00% NA
Temperate Japonica  767 0.50% 97.30% 0.13% 2.09% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 85.10% 7.05% 0.00% NA
VI/Aromatic  96 25.00% 72.90% 2.08% 0.00% NA
Intermediate  90 50.00% 46.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319913239 A -> DEL N N silent_mutation Average:47.119; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0319913239 A -> G LOC_Os03g35886.1 upstream_gene_variant ; 4682.0bp to feature; MODIFIER silent_mutation Average:47.119; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0319913239 A -> G LOC_Os03g35894.1 downstream_gene_variant ; 2886.0bp to feature; MODIFIER silent_mutation Average:47.119; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0319913239 A -> G LOC_Os03g35910.1 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:47.119; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0319913239 A -> G LOC_Os03g35886-LOC_Os03g35894 intergenic_region ; MODIFIER silent_mutation Average:47.119; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319913239 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 4.24E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.58E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 6.41E-10 2.50E-14 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 7.12E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 1.24E-13 8.89E-25 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.18E-17 mr1933 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 5.48E-07 5.48E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 2.08E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 2.18E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.39E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 1.20E-07 4.16E-28 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.77E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 8.50E-24 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319913239 NA 1.83E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251