\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319868224:

Variant ID: vg0319868224 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19868224
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAGGACTTCCGCGAATCCCGTGAGCGTGGGCTAGCGATGAGGGTTGCCGTTGTTGCGGAATCCAATTAGATGATGTGGATCGCCGTTGTTGCGGGATC[T/C]
GATGATTTGCCGTTGTTGCGGGAATCACCCGCGGAGATAAATGTCAGATGGGATTGATGAAAAGCTTGTGACCTTAGCCTTGCCGGCATACACCATGAAG

Reverse complement sequence

CTTCATGGTGTATGCCGGCAAGGCTAAGGTCACAAGCTTTTCATCAATCCCATCTGACATTTATCTCCGCGGGTGATTCCCGCAACAACGGCAAATCATC[A/G]
GATCCCGCAACAACGGCGATCCACATCATCTAATTGGATTCCGCAACAACGGCAACCCTCATCGCTAGCCCACGCTCACGGGATTCGCGGAAGTCCTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 31.80% 0.49% 1.25% NA
All Indica  2759 95.60% 2.30% 0.76% 1.38% NA
All Japonica  1512 12.80% 86.00% 0.00% 1.26% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 96.80% 1.50% 0.84% 0.84% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 95.40% 1.10% 0.55% 2.96% NA
Indica Intermediate  786 93.80% 4.10% 1.40% 0.76% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 85.10% 0.00% 7.47% NA
VI/Aromatic  96 26.00% 71.90% 0.00% 2.08% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319868224 T -> C LOC_Os03g35849.1 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0319868224 T -> C LOC_Os03g35849.2 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0319868224 T -> C LOC_Os03g35849-LOC_Os03g35860 intergenic_region ; MODIFIER silent_mutation Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0319868224 T -> DEL N N silent_mutation Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319868224 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 1.56E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 4.92E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 9.80E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 2.36E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 6.00E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 6.08E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 2.76E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 2.04E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 5.46E-10 1.65E-20 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 1.63E-06 1.63E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 3.68E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 1.51E-09 1.63E-16 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 7.08E-27 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224 NA 2.60E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251