Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319868224:

Variant ID: vg0319868224 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19868224
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAGGACTTCCGCGAATCCCGTGAGCGTGGGCTAGCGATGAGGGTTGCCGTTGTTGCGGAATCCAATTAGATGATGTGGATCGCCGTTGTTGCGGGATC[T/C]
GATGATTTGCCGTTGTTGCGGGAATCACCCGCGGAGATAAATGTCAGATGGGATTGATGAAAAGCTTGTGACCTTAGCCTTGCCGGCATACACCATGAAG

Reverse complement sequence

CTTCATGGTGTATGCCGGCAAGGCTAAGGTCACAAGCTTTTCATCAATCCCATCTGACATTTATCTCCGCGGGTGATTCCCGCAACAACGGCAAATCATC[A/G]
GATCCCGCAACAACGGCGATCCACATCATCTAATTGGATTCCGCAACAACGGCAACCCTCATCGCTAGCCCACGCTCACGGGATTCGCGGAAGTCCTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	31.80%	0.49%	1.25%	NA
All Indica	2759	95.60%	2.30%	0.76%	1.38%	NA
All Japonica	1512	12.80%	86.00%	0.00%	1.26%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	96.80%	1.50%	0.84%	0.84%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	95.40%	1.10%	0.55%	2.96%	NA
Indica Intermediate	786	93.80%	4.10%	1.40%	0.76%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.50%	85.10%	0.00%	7.47%	NA
VI/Aromatic	96	26.00%	71.90%	0.00%	2.08%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319868224	T -> C	LOC_Os03g35849.1	upstream_gene_variant ; 984.0bp to feature; MODIFIER	silent_mutation	Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg0319868224	T -> C	LOC_Os03g35849.2	upstream_gene_variant ; 984.0bp to feature; MODIFIER	silent_mutation	Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg0319868224	T -> C	LOC_Os03g35849-LOC_Os03g35860	intergenic_region ; MODIFIER	silent_mutation	Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N
vg0319868224	T -> DEL	N	N	silent_mutation	Average:59.51; most accessible tissue: Zhenshan97 flag leaf, score: 75.455	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319868224	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	1.56E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	4.92E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	9.80E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	2.36E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	6.00E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	6.08E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	2.76E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	2.04E-06	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	5.46E-10	1.65E-20	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	1.63E-06	1.63E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	3.68E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	1.51E-09	1.63E-16	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	7.08E-27	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319868224	NA	2.60E-22	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251