Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319863646:

Variant ID: vg0319863646 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19863646
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGAGTACATACTGCTGTAAAAAAAAATTACTTTAACAATTGAACATAAAAGTGCTCACTTAAACATCATTTTAATTTCGAGGACGAAATTATTTTTTA[G/A]
GGGGGGGTGGAGGTAGGATGTAACATCCCAGGTTTTAGCTATAGTCTTAGTCACGCTAATGACCTAGTCACACTGACTAAGAGCGGTGTCGATTGAGCCA

Reverse complement sequence

TGGCTCAATCGACACCGCTCTTAGTCAGTGTGACTAGGTCATTAGCGTGACTAAGACTATAGCTAAAACCTGGGATGTTACATCCTACCTCCACCCCCCC[C/T]
TAAAAAATAATTTCGTCCTCGAAATTAAAATGATGTTTAAGTGAGCACTTTTATGTTCAATTGTTAAAGTAATTTTTTTTTACAGCAGTATGTACTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	31.80%	0.02%	0.47%	NA
All Indica	2759	97.80%	2.10%	0.04%	0.07%	NA
All Japonica	1512	12.70%	86.10%	0.00%	1.19%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.70%	0.00%	0.25%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.10%	65.70%	0.00%	0.20%	NA
Japonica Intermediate	241	7.50%	85.50%	0.00%	7.05%	NA
VI/Aromatic	96	26.00%	71.90%	0.00%	2.08%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319863646	G -> A	LOC_Os03g35840.1	upstream_gene_variant ; 2730.0bp to feature; MODIFIER	silent_mutation	Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085	N	N	N	N
vg0319863646	G -> A	LOC_Os03g35849.1	downstream_gene_variant ; 1049.0bp to feature; MODIFIER	silent_mutation	Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085	N	N	N	N
vg0319863646	G -> A	LOC_Os03g35849.2	downstream_gene_variant ; 1049.0bp to feature; MODIFIER	silent_mutation	Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085	N	N	N	N
vg0319863646	G -> A	LOC_Os03g35840-LOC_Os03g35849	intergenic_region ; MODIFIER	silent_mutation	Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085	N	N	N	N
vg0319863646	G -> DEL	N	N	silent_mutation	Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319863646	NA	3.57E-08	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	2.14E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	5.59E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	3.88E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	4.28E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	1.66E-06	mr1350	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	5.98E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	5.36E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	6.66E-08	5.81E-118	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	5.38E-06	7.33E-10	mr1830	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	1.14E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	1.02E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	2.23E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	9.91E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	2.15E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	7.00E-108	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	1.10E-07	3.46E-151	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646	NA	8.89E-23	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251