\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319863646:

Variant ID: vg0319863646 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19863646
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGAGTACATACTGCTGTAAAAAAAAATTACTTTAACAATTGAACATAAAAGTGCTCACTTAAACATCATTTTAATTTCGAGGACGAAATTATTTTTTA[G/A]
GGGGGGGTGGAGGTAGGATGTAACATCCCAGGTTTTAGCTATAGTCTTAGTCACGCTAATGACCTAGTCACACTGACTAAGAGCGGTGTCGATTGAGCCA

Reverse complement sequence

TGGCTCAATCGACACCGCTCTTAGTCAGTGTGACTAGGTCATTAGCGTGACTAAGACTATAGCTAAAACCTGGGATGTTACATCCTACCTCCACCCCCCC[C/T]
TAAAAAATAATTTCGTCCTCGAAATTAAAATGATGTTTAAGTGAGCACTTTTATGTTCAATTGTTAAAGTAATTTTTTTTTACAGCAGTATGTACTCCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.80% 0.02% 0.47% NA
All Indica  2759 97.80% 2.10% 0.04% 0.07% NA
All Japonica  1512 12.70% 86.10% 0.00% 1.19% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.70% 0.00% 0.25% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.70% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 85.50% 0.00% 7.05% NA
VI/Aromatic  96 26.00% 71.90% 0.00% 2.08% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319863646 G -> A LOC_Os03g35840.1 upstream_gene_variant ; 2730.0bp to feature; MODIFIER silent_mutation Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0319863646 G -> A LOC_Os03g35849.1 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0319863646 G -> A LOC_Os03g35849.2 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0319863646 G -> A LOC_Os03g35840-LOC_Os03g35849 intergenic_region ; MODIFIER silent_mutation Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0319863646 G -> DEL N N silent_mutation Average:62.347; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319863646 NA 3.57E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 2.14E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 5.59E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 3.88E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 4.28E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 1.66E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 5.98E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 5.36E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 6.66E-08 5.81E-118 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 5.38E-06 7.33E-10 mr1830 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 1.14E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 1.02E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 2.23E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 9.91E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 2.15E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 7.00E-108 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 1.10E-07 3.46E-151 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319863646 NA 8.89E-23 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251