\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319832678:

Variant ID: vg0319832678 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19832678
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCGTTGGGAGAGAATCTTTTCATCCCACCTCGGACTTTCCAAGGTGACATCGGATAGTCCAATGTTTTTGACCCCCAAGCAAGCCAGAGATAGAGAAC[G/T]
AAATTCTGGAGAATTTCGGACAATCCGATCGATCGGATAGTCCGATGTCATATCGGATATTCCGTTATTTTTCAATCAAGAATTTCATCCTCTCACAGAG

Reverse complement sequence

CTCTGTGAGAGGATGAAATTCTTGATTGAAAAATAACGGAATATCCGATATGACATCGGACTATCCGATCGATCGGATTGTCCGAAATTCTCCAGAATTT[C/A]
GTTCTCTATCTCTGGCTTGCTTGGGGGTCAAAAACATTGGACTATCCGATGTCACCTTGGAAAGTCCGAGGTGGGATGAAAAGATTCTCTCCCAACGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 32.20% 4.23% 0.74% NA
All Indica  2759 90.00% 3.00% 6.89% 0.11% NA
All Japonica  1512 11.80% 85.70% 0.40% 2.05% NA
Aus  269 89.60% 10.40% 0.00% 0.00% NA
Indica I  595 75.80% 2.00% 22.18% 0.00% NA
Indica II  465 93.30% 3.70% 2.58% 0.43% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 89.20% 4.80% 5.85% 0.13% NA
Temperate Japonica  767 0.30% 98.00% 0.52% 1.17% NA
Tropical Japonica  504 31.50% 66.10% 0.00% 2.38% NA
Japonica Intermediate  241 7.50% 87.60% 0.83% 4.15% NA
VI/Aromatic  96 25.00% 72.90% 1.04% 1.04% NA
Intermediate  90 45.60% 51.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319832678 G -> T LOC_Os03g35788.1 downstream_gene_variant ; 1057.0bp to feature; MODIFIER silent_mutation Average:33.752; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0319832678 G -> T LOC_Os03g35750-LOC_Os03g35788 intergenic_region ; MODIFIER silent_mutation Average:33.752; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0319832678 G -> DEL N N silent_mutation Average:33.752; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319832678 NA 1.69E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 1.93E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 1.47E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 2.80E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 7.01E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 2.22E-06 1.26E-15 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 2.53E-06 2.53E-06 mr1834 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 4.32E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 1.96E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 9.33E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 1.27E-06 1.26E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 2.05E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 5.80E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 6.53E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 6.67E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 1.27E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 6.74E-06 2.58E-19 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 2.01E-15 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319832678 NA 3.66E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251