\
| Variant ID: vg0319801567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19801567 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGGAAGTTGAATTTGCTTCTCTCGGAGTAGCAGATCGAAGATCTTGTCAGCTTTAGTAATATCAAAATCATACTTCTCCTCTTTTCCAAAACTTTTCAC[C/T]
CATTGGCATGGTATGACCTTTTTACTCCTTACCCATTCGGCTGCAGCTATTTCAGGATCATCCTCATCATCATCCGATCCATACATGTACGGACAAACAT
ATGTTTGTCCGTACATGTATGGATCGGATGATGATGAGGATGATCCTGAAATAGCTGCAGCCGAATGGGTAAGGAGTAAAAAGGTCATACCATGCCAATG[G/A]
GTGAAAAGTTTTGGAAAAGAGGAGAAGTATGATTTTGATATTACTAAAGCTGACAAGATCTTCGATCTGCTACTCCGAGAGAAGCAAATTCAACTTCCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.20% | 31.50% | 0.30% | 1.06% | NA |
| All Indica | 2759 | 97.20% | 1.80% | 0.36% | 0.54% | NA |
| All Japonica | 1512 | 12.00% | 86.20% | 0.13% | 1.72% | NA |
| Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.20% | 0.84% | 0.17% | NA |
| Indica II | 465 | 96.60% | 2.60% | 0.22% | 0.65% | NA |
| Indica III | 913 | 98.80% | 0.80% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 95.40% | 3.20% | 0.51% | 0.89% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 31.90% | 65.30% | 0.40% | 2.38% | NA |
| Japonica Intermediate | 241 | 7.50% | 87.10% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 51.10% | 40.00% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319801567 | C -> T | LOC_Os03g35740.1 | stop_gained ; p.Trp451*; HIGH | stop_gained | Average:30.577; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg0319801567 | C -> DEL | LOC_Os03g35740.1 | N | frameshift_variant | Average:30.577; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319801567 | NA | 1.93E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | 1.48E-07 | 3.53E-11 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 2.49E-11 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 4.32E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 9.33E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 5.80E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 2.88E-10 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319801567 | NA | 7.20E-17 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |