\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319801567:

Variant ID: vg0319801567 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19801567
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGAAGTTGAATTTGCTTCTCTCGGAGTAGCAGATCGAAGATCTTGTCAGCTTTAGTAATATCAAAATCATACTTCTCCTCTTTTCCAAAACTTTTCAC[C/T]
CATTGGCATGGTATGACCTTTTTACTCCTTACCCATTCGGCTGCAGCTATTTCAGGATCATCCTCATCATCATCCGATCCATACATGTACGGACAAACAT

Reverse complement sequence

ATGTTTGTCCGTACATGTATGGATCGGATGATGATGAGGATGATCCTGAAATAGCTGCAGCCGAATGGGTAAGGAGTAAAAAGGTCATACCATGCCAATG[G/A]
GTGAAAAGTTTTGGAAAAGAGGAGAAGTATGATTTTGATATTACTAAAGCTGACAAGATCTTCGATCTGCTACTCCGAGAGAAGCAAATTCAACTTCCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 31.50% 0.30% 1.06% NA
All Indica  2759 97.20% 1.80% 0.36% 0.54% NA
All Japonica  1512 12.00% 86.20% 0.13% 1.72% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 97.80% 1.20% 0.84% 0.17% NA
Indica II  465 96.60% 2.60% 0.22% 0.65% NA
Indica III  913 98.80% 0.80% 0.00% 0.44% NA
Indica Intermediate  786 95.40% 3.20% 0.51% 0.89% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 31.90% 65.30% 0.40% 2.38% NA
Japonica Intermediate  241 7.50% 87.10% 0.00% 5.39% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 51.10% 40.00% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319801567 C -> T LOC_Os03g35740.1 stop_gained ; p.Trp451*; HIGH stop_gained Average:30.577; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg0319801567 C -> DEL LOC_Os03g35740.1 N frameshift_variant Average:30.577; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319801567 NA 1.93E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 1.48E-07 3.53E-11 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 2.49E-11 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 4.32E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 9.33E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 5.80E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 2.88E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319801567 NA 7.20E-17 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251