\
| Variant ID: vg0319794993 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19794993 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GATTAGAGCCGACTGTTAACGATGACGGAGAGGAACTCACTCATCGGAGATTCACATCATATGGAGAGTACGCCTCTACCCCAACTGCTGCAGGAGCAAA[A/G]
CTATCGGCCGAGCTGCTCAAAGATTGGTTTTGTAGCTTTTATGAGGGGTTCCAAAAGGATGCTCGAGCTTGGTTTCTCTATGGAGACTCAACACTTCTGG
CCAGAAGTGTTGAGTCTCCATAGAGAAACCAAGCTCGAGCATCCTTTTGGAACCCCTCATAAAAGCTACAAAACCAATCTTTGAGCAGCTCGGCCGATAG[T/C]
TTTGCTCCTGCAGCAGTTGGGGTAGAGGCGTACTCTCCATATGATGTGAATCTCCGATGAGTGAGTTCCTCTCCGTCATCGTTAACAGTCGGCTCTAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 11.20% | 26.98% | 0.36% | NA |
| All Indica | 2759 | 46.70% | 12.40% | 40.92% | 0.00% | NA |
| All Japonica | 1512 | 87.50% | 10.20% | 1.19% | 1.12% | NA |
| Aus | 269 | 59.10% | 8.20% | 32.71% | 0.00% | NA |
| Indica I | 595 | 42.70% | 6.90% | 50.42% | 0.00% | NA |
| Indica II | 465 | 38.30% | 12.50% | 49.25% | 0.00% | NA |
| Indica III | 913 | 55.50% | 13.70% | 30.78% | 0.00% | NA |
| Indica Intermediate | 786 | 44.40% | 15.00% | 40.59% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 68.70% | 27.60% | 2.78% | 0.99% | NA |
| Japonica Intermediate | 241 | 87.60% | 6.20% | 1.24% | 4.98% | NA |
| VI/Aromatic | 96 | 79.20% | 5.20% | 15.62% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 7.80% | 27.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319794993 | A -> DEL | LOC_Os03g35730.1 | N | frameshift_variant | Average:38.825; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| vg0319794993 | A -> G | LOC_Os03g35730.1 | synonymous_variant ; p.Lys189Lys; LOW | synonymous_codon | Average:38.825; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319794993 | NA | 5.05E-10 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 3.62E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 4.86E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 1.88E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 2.55E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 3.27E-07 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 1.53E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 1.81E-09 | mr1845 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 1.44E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 2.21E-09 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319794993 | NA | 3.42E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |