\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319793532:

Variant ID: vg0319793532 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19793532
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTCAACCCGATGTTGTACACCAAGTCGTATTGCCGGAATCGATTGTATCACCTAACCCAGTGTGATTGAGATTTAGCCGATTCTAGTCGTAGCCGATC[T/A]
GGACAACAGCCGATTCTTACTCTGTTCCCACAACAATCCTTATCTCCAACTCCGCTTAGATCCCATCTTCACCTCCGACGGTGATATTACCAAATTCGGT

Reverse complement sequence

ACCGAATTTGGTAATATCACCGTCGGAGGTGAAGATGGGATCTAAGCGGAGTTGGAGATAAGGATTGTTGTGGGAACAGAGTAAGAATCGGCTGTTGTCC[A/T]
GATCGGCTACGACTAGAATCGGCTAAATCTCAATCACACTGGGTTAGGTGATACAATCGATTCCGGCAATACGACTTGGTGTACAACATCGGGTTGAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 32.40% 6.24% 2.67% NA
All Indica  2759 83.50% 3.00% 10.11% 3.33% NA
All Japonica  1512 11.80% 86.40% 0.07% 1.65% NA
Aus  269 87.00% 10.00% 1.49% 1.49% NA
Indica I  595 79.00% 4.00% 14.29% 2.69% NA
Indica II  465 83.00% 3.70% 10.54% 2.80% NA
Indica III  913 89.30% 1.10% 6.02% 3.61% NA
Indica Intermediate  786 80.70% 4.10% 11.45% 3.82% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 31.50% 65.90% 0.20% 2.38% NA
Japonica Intermediate  241 7.50% 87.10% 0.00% 5.39% NA
VI/Aromatic  96 24.00% 71.90% 2.08% 2.08% NA
Intermediate  90 37.80% 48.90% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319793532 T -> A LOC_Os03g35730.1 upstream_gene_variant ; 895.0bp to feature; MODIFIER silent_mutation Average:36.448; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0319793532 T -> A LOC_Os03g35720-LOC_Os03g35730 intergenic_region ; MODIFIER silent_mutation Average:36.448; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0319793532 T -> DEL N N silent_mutation Average:36.448; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319793532 NA 1.94E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 6.04E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 2.68E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 4.48E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 1.93E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 2.34E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 1.53E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 5.29E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 9.00E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 9.10E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 5.82E-14 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 3.89E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 4.32E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 9.33E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 5.80E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 2.42E-08 1.93E-15 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 4.45E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 1.07E-22 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 4.51E-06 7.58E-06 mr1761_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 1.30E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319793532 NA 4.36E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251