\
| Variant ID: vg0319749387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19749387 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCATGTGGGGTGCAACCCAATCTGGTGTAGCATGACCCCTGGACCCTCTTGGTCGTCCTCCCACCTCTATAAATAGTTAGGTACCCCTTTAGAGTTTCTC[A/G]
GGTTCTGATAGATTAAAGTTTAGCCATTGCTACTTGCTTGTAGCGCACGTGTCAGCTAGACCGTCCGTCTGCTTGTTCTTCGAAACCCCAACTTATCATT
AATGATAAGTTGGGGTTTCGAAGAACAAGCAGACGGACGGTCTAGCTGACACGTGCGCTACAAGCAAGTAGCAATGGCTAAACTTTAATCTATCAGAACC[T/C]
GAGAAACTCTAAAGGGGTACCTAACTATTTATAGAGGTGGGAGGACGACCAAGAGGGTCCAGGGGTCATGCTACACCAGATTGGGTTGCACCCCACATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 16.60% | 0.49% | 2.07% | NA |
| All Indica | 2759 | 99.10% | 0.40% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 43.50% | 49.70% | 1.06% | 5.69% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 98.50% | 0.40% | 0.38% | 0.76% | NA |
| Temperate Japonica | 767 | 8.30% | 83.70% | 1.04% | 6.91% | NA |
| Tropical Japonica | 504 | 87.90% | 9.10% | 0.20% | 2.78% | NA |
| Japonica Intermediate | 241 | 62.70% | 26.60% | 2.90% | 7.88% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319749387 | A -> DEL | N | N | silent_mutation | Average:46.003; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0319749387 | A -> G | LOC_Os03g35650.1 | downstream_gene_variant ; 886.0bp to feature; MODIFIER | silent_mutation | Average:46.003; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0319749387 | A -> G | LOC_Os03g35650-LOC_Os03g35670 | intergenic_region ; MODIFIER | silent_mutation | Average:46.003; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319749387 | NA | 5.33E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 6.15E-07 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 8.01E-06 | NA | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 7.53E-08 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 5.61E-06 | NA | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | NA | 7.57E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 7.01E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | NA | 5.23E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | NA | 3.71E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 1.65E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | NA | 3.31E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | NA | 8.57E-07 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319749387 | 6.92E-07 | NA | mr1933_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |