Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319746180:

Variant ID: vg0319746180 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19746180
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAGGATGGAGTAACACGTATCGTGCTGGTGTAAGGCTAAATCATGAATTTTGGAAAAGCTTTGTTGTGGGTAATAAATCGGGTACTTATGTATCGCGT[A/G]
CCATGCTCTTGCATGATTATTATTTCGCATCATGTGGGTAAAGTGTACAAACTCTGTAGAGTAAAAACTAATCGATTAGCCGTGCTCGCGGTCAAAAGCG

Reverse complement sequence

CGCTTTTGACCGCGAGCACGGCTAATCGATTAGTTTTTACTCTACAGAGTTTGTACACTTTACCCACATGATGCGAAATAATAATCATGCAAGAGCATGG[T/C]
ACGCGATACATAAGTACCCGATTTATTACCCACAACAAAGCTTTTCCAAAATTCATGATTTAGCCTTACACCAGCACGATACGTGTTACTCCATCCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	35.50%	9.25%	0.23%	NA
All Indica	2759	87.60%	6.30%	6.09%	0.00%	NA
All Japonica	1512	3.10%	87.50%	8.66%	0.73%	NA
Aus	269	35.30%	19.00%	45.72%	0.00%	NA
Indica I	595	91.60%	3.20%	5.21%	0.00%	NA
Indica II	465	91.80%	3.70%	4.52%	0.00%	NA
Indica III	913	84.40%	7.90%	7.67%	0.00%	NA
Indica Intermediate	786	85.80%	8.40%	5.85%	0.00%	NA
Temperate Japonica	767	0.40%	94.10%	4.04%	1.43%	NA
Tropical Japonica	504	8.10%	76.20%	15.67%	0.00%	NA
Japonica Intermediate	241	1.20%	90.00%	8.71%	0.00%	NA
VI/Aromatic	96	7.30%	83.30%	9.38%	0.00%	NA
Intermediate	90	38.90%	54.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319746180	A -> DEL	N	N	silent_mutation	Average:29.928; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0319746180	A -> G	LOC_Os03g35640.1	upstream_gene_variant ; 2532.0bp to feature; MODIFIER	silent_mutation	Average:29.928; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0319746180	A -> G	LOC_Os03g35650.1	intron_variant ; MODIFIER	silent_mutation	Average:29.928; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319746180	NA	3.11E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	1.69E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	9.87E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	9.93E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	4.98E-06	7.12E-06	mr1201_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	6.66E-06	mr1219_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	1.73E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	7.92E-13	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319746180	NA	5.32E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251