\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319680247:

Variant ID: vg0319680247 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19680247
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCGATGAAGTTTTCAGTTTTCAAAGTCAGGGCTCTTTGTAAATCAGAGGAGGGTTGGTTATTTTTCAAGGACAGCAGTTCAATTGTTCCCAGTCAGG[C/T]
GAAATGTATGACTACTCCTGTAAGGGGGGTAGGTCGCCGAGATGAGTTCTGGCTCACCTCGTCGCTGTTTCAGTTGAAGGTGCAACCTAGTGCGGCAATC

Reverse complement sequence

GATTGCCGCACTAGGTTGCACCTTCAACTGAAACAGCGACGAGGTGAGCCAGAACTCATCTCGGCGACCTACCCCCCTTACAGGAGTAGTCATACATTTC[G/A]
CCTGACTGGGAACAATTGAACTGCTGTCCTTGAAAAATAACCAACCCTCCTCTGATTTACAAAGAGCCCTGACTTTGAAAACTGAAAACTTCATCGATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 37.80% 5.92% 14.94% NA
All Indica  2759 68.20% 5.10% 8.12% 18.56% NA
All Japonica  1512 3.00% 83.30% 2.12% 11.57% NA
Aus  269 0.00% 93.70% 4.46% 1.86% NA
Indica I  595 88.10% 1.70% 5.55% 4.71% NA
Indica II  465 66.90% 3.90% 7.96% 21.29% NA
Indica III  913 58.50% 7.10% 8.32% 26.07% NA
Indica Intermediate  786 65.40% 6.00% 9.92% 18.70% NA
Temperate Japonica  767 0.00% 99.70% 0.13% 0.13% NA
Tropical Japonica  504 7.90% 60.30% 2.98% 28.77% NA
Japonica Intermediate  241 2.10% 79.30% 6.64% 12.03% NA
VI/Aromatic  96 2.10% 95.80% 2.08% 0.00% NA
Intermediate  90 27.80% 45.60% 11.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319680247 C -> T LOC_Os03g35500.1 missense_variant ; p.Ala112Val; MODERATE nonsynonymous_codon ; A112V Average:57.254; most accessible tissue: Zhenshan97 young leaf, score: 80.325 unknown unknown DELETERIOUS 0.00
vg0319680247 C -> DEL LOC_Os03g35500.1 N frameshift_variant Average:57.254; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319680247 NA 1.05E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.06E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.39E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 4.93E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 6.92E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 4.27E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 5.75E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 4.61E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.10E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 7.20E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.20E-30 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 8.65E-07 1.86E-15 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 2.07E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 4.17E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 2.29E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 2.71E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.29E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 7.79E-07 3.38E-10 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 2.24E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 1.86E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 7.28E-11 1.63E-23 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319680247 NA 1.10E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251