\
| Variant ID: vg0319641267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19641267 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAGCTTTAAACGGGATCAACATACTCAAAGGGTTGTTTGGGATCTGTGTAACTTGCCTTGCTGGCCTTGGAACTCTTCAAATTCTTCTCTTGCAAAAAC[G/T]
GACTCTCCGGAAACGTCGGAATCTAAAGAGAAAAGAGCAAAATCACCAAAACAGCACATAAAAAAGCATGAACAGTACATGTGGATATTTTAACATGTAG
CTACATGTTAAAATATCCACATGTACTGTTCATGCTTTTTTATGTGCTGTTTTGGTGATTTTGCTCTTTTCTCTTTAGATTCCGACGTTTCCGGAGAGTC[C/A]
GTTTTTGCAAGAGAAGAATTTGAAGAGTTCCAAGGCCAGCAAGGCAAGTTACACAGATCCCAAACAACCCTTTGAGTATGTTGATCCCGTTTAAAGCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 0.40% | 30.00% | 36.90% | NA |
| All Indica | 2759 | 3.60% | 0.50% | 37.77% | 58.10% | NA |
| All Japonica | 1512 | 86.00% | 0.10% | 11.44% | 2.51% | NA |
| Aus | 269 | 10.40% | 0.00% | 63.20% | 26.39% | NA |
| Indica I | 595 | 3.90% | 0.00% | 39.33% | 56.81% | NA |
| Indica II | 465 | 4.30% | 1.50% | 29.25% | 64.95% | NA |
| Indica III | 913 | 1.60% | 0.00% | 47.65% | 50.71% | NA |
| Indica Intermediate | 786 | 5.20% | 1.00% | 30.15% | 63.61% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 66.50% | 0.00% | 31.35% | 2.18% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.40% | 6.22% | 9.96% | NA |
| VI/Aromatic | 96 | 71.90% | 0.00% | 21.88% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 1.10% | 13.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319641267 | G -> T | LOC_Os03g35420.1 | missense_variant ; p.Pro31Gln; MODERATE | nonsynonymous_codon ; P31Q | Average:7.841; most accessible tissue: Callus, score: 9.865 | probably damaging |
2.093 |
DELETERIOUS | 0.00 |
| vg0319641267 | G -> DEL | LOC_Os03g35420.1 | N | frameshift_variant | Average:7.841; most accessible tissue: Callus, score: 9.865 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319641267 | NA | 2.87E-16 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 2.08E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 5.44E-06 | mr1314 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 9.91E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | 4.63E-06 | 4.63E-06 | mr1419 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 7.87E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 3.06E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 5.34E-10 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 7.97E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | 7.81E-06 | 7.81E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 4.47E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 1.17E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 2.78E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 5.75E-08 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | 9.02E-06 | 9.01E-06 | mr1774 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 9.44E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 3.87E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 4.30E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 4.69E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319641267 | NA | 6.81E-06 | mr1988 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |