\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319619967:

Variant ID: vg0319619967 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19619967
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACGGCCGCTCCGCCGCTAAGGCGCGCCTTTTGGAGCAGCTGGCGAAAGCAGAGGCGGCGGACCTTTGTGAAGAGGAAGGCGCGGCGGCCGGAGGGGGT[A/G]
GAGGCGATGCCCAGGACCACCCAGAGGTGTGAGGCCCTCCGCCCTTCTCTTAGATTTTCATAGTTTTCTTTTGGTGTTCGCTAGATGTGGCGAACCGTTG

Reverse complement sequence

CAACGGTTCGCCACATCTAGCGAACACCAAAAGAAAACTATGAAAATCTAAGAGAAGGGCGGAGGGCCTCACACCTCTGGGTGGTCCTGGGCATCGCCTC[T/C]
ACCCCCTCCGGCCGCCGCGCCTTCCTCTTCACAAAGGTCCGCCGCCTCTGCTTTCGCCAGCTGCTCCAAAAGGCGCGCCTTAGCGGCGGAGCGGCCGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 28.00% 2.77% 1.69% NA
All Indica  2759 97.10% 1.80% 1.09% 0.07% NA
All Japonica  1512 13.20% 76.50% 5.56% 4.70% NA
Aus  269 90.00% 6.70% 2.60% 0.74% NA
Indica I  595 96.30% 1.50% 2.18% 0.00% NA
Indica II  465 96.60% 2.20% 1.29% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 95.90% 2.50% 1.27% 0.25% NA
Temperate Japonica  767 0.40% 96.30% 2.48% 0.78% NA
Tropical Japonica  504 34.50% 47.00% 6.94% 11.51% NA
Japonica Intermediate  241 9.50% 75.10% 12.45% 2.90% NA
VI/Aromatic  96 27.10% 69.80% 1.04% 2.08% NA
Intermediate  90 48.90% 37.80% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319619967 A -> DEL LOC_Os03g35380.1 N frameshift_variant Average:20.36; most accessible tissue: Callus, score: 31.601 N N N N
vg0319619967 A -> G LOC_Os03g35380.1 missense_variant ; p.Arg875Gly; MODERATE nonsynonymous_codon ; R875V Average:20.36; most accessible tissue: Callus, score: 31.601 unknown unknown DELETERIOUS 0.01
vg0319619967 A -> G LOC_Os03g35380.1 missense_variant ; p.Arg875Gly; MODERATE nonsynonymous_codon ; R875G Average:20.36; most accessible tissue: Callus, score: 31.601 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319619967 NA 4.29E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 3.91E-06 3.91E-06 mr1173 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 9.91E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 1.11E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 2.01E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 3.06E-08 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 1.00E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 6.90E-17 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 4.68E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 1.11E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 3.64E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319619967 NA 1.64E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251