Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319509282:

Variant ID: vg0319509282 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19509282
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCAAAAGTAAAGGGTGTAGCTGTGTTAAAGGTCAGACAAGGCAAAATAACAAAGCACAGGAGTGTACAGCAAAAGAACGGTCTTACTATTCATCCCCT[C/T]
AGGAAGAACCAAGTTCGGCAAACCATCAGCCTCTTCGCATTGCTCGACCGTGACCCGCCATGACTGGGAGAGGGGAAAGATGCGAAGCATACAGAACTCC

Reverse complement sequence

GGAGTTCTGTATGCTTCGCATCTTTCCCCTCTCCCAGTCATGGCGGGTCACGGTCGAGCAATGCGAAGAGGCTGATGGTTTGCCGAACTTGGTTCTTCCT[G/A]
AGGGGATGAATAGTAAGACCGTTCTTTTGCTGTACACTCCTGTGCTTTGTTATTTTGCCTTGTCTGACCTTTAACACAGCTACACCCTTTACTTTTGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.70% 0.19% 0.74% NA
All Indica  2759 97.10% 2.30% 0.29% 0.29% NA
All Japonica  1512 12.80% 85.70% 0.00% 1.52% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.00% 1.30% 0.50% 0.17% NA
Indica II  465 96.60% 2.80% 0.65% 0.00% NA
Indica III  913 98.50% 1.30% 0.11% 0.11% NA
Indica Intermediate  786 95.30% 3.80% 0.13% 0.76% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 83.40% 0.00% 9.13% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 48.90% 48.90% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319509282 C -> T LOC_Os03g34270.1 missense_variant ; p.Glu276Lys; MODERATE nonsynonymous_codon ; E276K Average:71.758; most accessible tissue: Zhenshan97 flag leaf, score: 88.022 unknown unknown TOLERATED 0.14
vg0319509282 C -> DEL LOC_Os03g34270.1 N frameshift_variant Average:71.758; most accessible tissue: Zhenshan97 flag leaf, score: 88.022 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0319509282 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319509282 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 1.10E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 2.99E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 6.27E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 4.94E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 2.04E-08 2.92E-19 mr1750 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 9.32E-08 9.32E-08 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 2.11E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 5.31E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 5.75E-09 3.51E-25 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319509282 NA 3.89E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251