| Variant ID: vg0319456132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19456132 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTCATAACTAATTCATCTTAGCTCGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTT[A/C,T]
ATGCTTGTTTATGTGCTGTTTGGTGATTTTGCTCCTTTCTGTTTAGATTCCGACGTTTCCGGAGAGTCTGTTTTCGCAGGAGAAGAATTTGAAGAGTTCC
GGAACTCTTCAAATTCTTCTCCTGCGAAAACAGACTCTCCGGAAACGTCGGAATCTAAACAGAAAGGAGCAAAATCACCAAACAGCACATAAACAAGCAT[T/G,A]
AACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCGAGCTAAGATGAATTAGTTATGAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 4.90% | 22.94% | 39.40% | T: 0.11% |
| All Indica | 2759 | 4.20% | 0.90% | 34.65% | 60.06% | T: 0.18% |
| All Japonica | 1512 | 84.90% | 6.20% | 4.23% | 4.70% | NA |
| Aus | 269 | 10.80% | 35.30% | 16.73% | 37.17% | NA |
| Indica I | 595 | 3.00% | 0.00% | 18.32% | 78.66% | NA |
| Indica II | 465 | 4.90% | 0.20% | 18.49% | 75.91% | T: 0.43% |
| Indica III | 913 | 3.10% | 0.90% | 59.47% | 36.47% | T: 0.11% |
| Indica Intermediate | 786 | 6.10% | 1.90% | 27.74% | 63.99% | T: 0.25% |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 63.10% | 16.10% | 9.52% | 11.31% | NA |
| Japonica Intermediate | 241 | 83.40% | 5.40% | 6.64% | 4.56% | NA |
| VI/Aromatic | 96 | 72.90% | 15.60% | 5.21% | 6.25% | NA |
| Intermediate | 90 | 51.10% | 2.20% | 15.56% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319456132 | A -> C | LOC_Os03g34160.1 | upstream_gene_variant ; 605.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> C | LOC_Os03g34150.1 | downstream_gene_variant ; 2742.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> C | LOC_Os03g34170.1 | downstream_gene_variant ; 1923.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> C | LOC_Os03g34160-LOC_Os03g34170 | intergenic_region ; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> DEL | N | N | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> T | LOC_Os03g34160.1 | upstream_gene_variant ; 605.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> T | LOC_Os03g34150.1 | downstream_gene_variant ; 2742.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> T | LOC_Os03g34170.1 | downstream_gene_variant ; 1923.0bp to feature; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0319456132 | A -> T | LOC_Os03g34160-LOC_Os03g34170 | intergenic_region ; MODIFIER | silent_mutation | Average:7.241; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319456132 | NA | 7.62E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 6.56E-08 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 4.59E-06 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 3.52E-15 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 4.97E-10 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 4.67E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 3.38E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 7.52E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 4.58E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 1.56E-21 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 8.48E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 7.48E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 1.32E-16 | mr1827_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 2.07E-14 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319456132 | NA | 3.04E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |