Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319440543:

Variant ID: vg0319440543 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19440543
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAATGACAGACGGCGACGGAAGATGGCCGGCGACGAGCTTCGAAGGGTGGCGAGGTACTGTCCACGGCGGCAACGATTTTCCGGCAACGAACGGAGGCAA[C/T]
AGAGGGGTGGACGGGTTTCACTTCGCAGCTGCGACGCCGAGGGAGGCTGCGGCGAAGCTTGGCGATGACGGAAGGAGCAGCAAGGCCTTGCCGGAGATCA

Reverse complement sequence

TGATCTCCGGCAAGGCCTTGCTGCTCCTTCCGTCATCGCCAAGCTTCGCCGCAGCCTCCCTCGGCGTCGCAGCTGCGAAGTGAAACCCGTCCACCCCTCT[G/A]
TTGCCTCCGTTCGTTGCCGGAAAATCGTTGCCGCCGTGGACAGTACCTCGCCACCCTTCGAAGCTCGTCGCCGGCCATCTTCCGTCGCCGTCTGTCATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	2.50%	2.18%	0.04%	NA
All Indica	2759	92.20%	4.20%	3.55%	0.04%	NA
All Japonica	1512	99.60%	0.00%	0.33%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	72.90%	14.10%	12.94%	0.00%	NA
Indica II	465	98.50%	0.90%	0.65%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	3.60%	2.29%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.00%	2.07%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319440543	C -> T	LOC_Os03g34129.1	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0319440543	C -> T	LOC_Os03g34120.1	intron_variant ; MODIFIER	silent_mutation	Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg0319440543	C -> DEL	N	N	silent_mutation	Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319440543	9.73E-06	6.67E-13	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	3.79E-12	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	4.66E-15	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	6.74E-13	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	3.75E-09	5.82E-19	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	4.46E-08	1.71E-16	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	8.58E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	2.88E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	4.97E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	1.94E-09	7.61E-17	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	3.30E-08	3.10E-15	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543	NA	4.01E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251