\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319440543:

Variant ID: vg0319440543 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19440543
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGACAGACGGCGACGGAAGATGGCCGGCGACGAGCTTCGAAGGGTGGCGAGGTACTGTCCACGGCGGCAACGATTTTCCGGCAACGAACGGAGGCAA[C/T]
AGAGGGGTGGACGGGTTTCACTTCGCAGCTGCGACGCCGAGGGAGGCTGCGGCGAAGCTTGGCGATGACGGAAGGAGCAGCAAGGCCTTGCCGGAGATCA

Reverse complement sequence

TGATCTCCGGCAAGGCCTTGCTGCTCCTTCCGTCATCGCCAAGCTTCGCCGCAGCCTCCCTCGGCGTCGCAGCTGCGAAGTGAAACCCGTCCACCCCTCT[G/A]
TTGCCTCCGTTCGTTGCCGGAAAATCGTTGCCGCCGTGGACAGTACCTCGCCACCCTTCGAAGCTCGTCGCCGGCCATCTTCCGTCGCCGTCTGTCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 2.50% 2.18% 0.04% NA
All Indica  2759 92.20% 4.20% 3.55% 0.04% NA
All Japonica  1512 99.60% 0.00% 0.33% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 72.90% 14.10% 12.94% 0.00% NA
Indica II  465 98.50% 0.90% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 3.60% 2.29% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 0.00% 2.07% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319440543 C -> T LOC_Os03g34129.1 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0319440543 C -> T LOC_Os03g34120.1 intron_variant ; MODIFIER silent_mutation Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0319440543 C -> DEL N N silent_mutation Average:47.535; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319440543 9.73E-06 6.67E-13 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 3.79E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 4.66E-15 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 6.74E-13 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 3.75E-09 5.82E-19 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 4.46E-08 1.71E-16 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 8.58E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 2.88E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 4.97E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 1.94E-09 7.61E-17 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 3.30E-08 3.10E-15 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319440543 NA 4.01E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251