\
| Variant ID: vg0319437084 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19437084 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 54. )
ACACCAACACTAAATGAGATCATTGATGACACGACACATATATCTCTTGCAGTGTCTCATGTTGGGTCTATTCAACAACATGTTCATTAACATGTGTCCA[C/T]
ATTATTAATTTGGTATCTCTATACCATGATCCATGAGACATGATCATCAATTAATACATATGCTGATCATATAAACATATTTGTTCCACATATGATATTT
AAATATCATATGTGGAACAAATATGTTTATATGATCAGCATATGTATTAATTGATGATCATGTCTCATGGATCATGGTATAGAGATACCAAATTAATAAT[G/A]
TGGACACATGTTAATGAACATGTTGTTGAATAGACCCAACATGAGACACTGCAAGAGATATATGTGTCGTGTCATCAATGATCTCATTTAGTGTTGGTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 35.00% | 2.86% | 3.68% | NA |
| All Indica | 2759 | 82.30% | 7.60% | 4.68% | 5.36% | NA |
| All Japonica | 1512 | 12.70% | 85.80% | 0.13% | 1.32% | NA |
| Aus | 269 | 89.60% | 9.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 97.30% | 2.20% | 0.17% | 0.34% | NA |
| Indica II | 465 | 48.60% | 17.00% | 16.34% | 18.06% | NA |
| Indica III | 913 | 93.40% | 3.30% | 1.10% | 2.19% | NA |
| Indica Intermediate | 786 | 78.10% | 11.20% | 5.34% | 5.34% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.10% | 65.50% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 7.50% | 84.20% | 0.83% | 7.47% | NA |
| VI/Aromatic | 96 | 22.90% | 74.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 40.00% | 54.40% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319437084 | C -> T | LOC_Os03g34102.1 | upstream_gene_variant ; 2915.0bp to feature; MODIFIER | silent_mutation | Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0319437084 | C -> T | LOC_Os03g34120.1 | upstream_gene_variant ; 3381.0bp to feature; MODIFIER | silent_mutation | Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0319437084 | C -> T | LOC_Os03g34129.1 | downstream_gene_variant ; 4453.0bp to feature; MODIFIER | silent_mutation | Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0319437084 | C -> T | LOC_Os03g34102-LOC_Os03g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0319437084 | C -> DEL | N | N | silent_mutation | Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319437084 | NA | 1.83E-14 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 6.64E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 8.79E-11 | mr1439 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 9.64E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 3.67E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319437084 | NA | 6.14E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |