\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319437084:

Variant ID: vg0319437084 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19437084
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


ACACCAACACTAAATGAGATCATTGATGACACGACACATATATCTCTTGCAGTGTCTCATGTTGGGTCTATTCAACAACATGTTCATTAACATGTGTCCA[C/T]
ATTATTAATTTGGTATCTCTATACCATGATCCATGAGACATGATCATCAATTAATACATATGCTGATCATATAAACATATTTGTTCCACATATGATATTT

Reverse complement sequence

AAATATCATATGTGGAACAAATATGTTTATATGATCAGCATATGTATTAATTGATGATCATGTCTCATGGATCATGGTATAGAGATACCAAATTAATAAT[G/A]
TGGACACATGTTAATGAACATGTTGTTGAATAGACCCAACATGAGACACTGCAAGAGATATATGTGTCGTGTCATCAATGATCTCATTTAGTGTTGGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 35.00% 2.86% 3.68% NA
All Indica  2759 82.30% 7.60% 4.68% 5.36% NA
All Japonica  1512 12.70% 85.80% 0.13% 1.32% NA
Aus  269 89.60% 9.70% 0.00% 0.74% NA
Indica I  595 97.30% 2.20% 0.17% 0.34% NA
Indica II  465 48.60% 17.00% 16.34% 18.06% NA
Indica III  913 93.40% 3.30% 1.10% 2.19% NA
Indica Intermediate  786 78.10% 11.20% 5.34% 5.34% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.50% 0.00% 0.40% NA
Japonica Intermediate  241 7.50% 84.20% 0.83% 7.47% NA
VI/Aromatic  96 22.90% 74.00% 2.08% 1.04% NA
Intermediate  90 40.00% 54.40% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319437084 C -> T LOC_Os03g34102.1 upstream_gene_variant ; 2915.0bp to feature; MODIFIER silent_mutation Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0319437084 C -> T LOC_Os03g34120.1 upstream_gene_variant ; 3381.0bp to feature; MODIFIER silent_mutation Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0319437084 C -> T LOC_Os03g34129.1 downstream_gene_variant ; 4453.0bp to feature; MODIFIER silent_mutation Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0319437084 C -> T LOC_Os03g34102-LOC_Os03g34120 intergenic_region ; MODIFIER silent_mutation Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0319437084 C -> DEL N N silent_mutation Average:38.939; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319437084 NA 1.83E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 6.64E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 8.79E-11 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 9.64E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 3.67E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319437084 NA 6.14E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251