Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319435119:

Variant ID: vg0319435119 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19435119
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAAGAACAAGCAAACCAAGAGAGGAGACACGTTGATTTGTTTCCCGAAGTTCGGATCCACGGATCCTACATCTTCGTTGAGGGGCCACAAGACCGGGT[C/T]
TATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCGGTTTCACTCTTGATTTCTTCCCTTGCGGAGGCGAAATCGAAGCCTTCACAAACTTT

Reverse complement sequence

AAAGTTTGTGAAGGCTTCGATTTCGCCTCCGCAAGGGAAGAAATCAAGAGTGAAACCGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATA[G/A]
ACCCGGTCTTGTGGCCCCTCAACGAAGATGTAGGATCCGTGGATCCGAACTTCGGGAAACAAATCAACGTGTCTCCTCTCTTGGTTTGCTTGTTCTTGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	32.80%	0.40%	0.53%	NA
All Indica	2759	95.40%	3.90%	0.65%	0.11%	NA
All Japonica	1512	12.80%	85.80%	0.00%	1.46%	NA
Aus	269	89.20%	10.40%	0.37%	0.00%	NA
Indica I	595	96.10%	2.20%	1.68%	0.00%	NA
Indica II	465	94.80%	4.30%	0.86%	0.00%	NA
Indica III	913	96.60%	3.30%	0.11%	0.00%	NA
Indica Intermediate	786	93.60%	5.60%	0.38%	0.38%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	33.90%	65.90%	0.00%	0.20%	NA
Japonica Intermediate	241	7.90%	83.40%	0.00%	8.71%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319435119	C -> T	LOC_Os03g34096.1	upstream_gene_variant ; 3606.0bp to feature; MODIFIER	silent_mutation	Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0319435119	C -> T	LOC_Os03g34102.1	upstream_gene_variant ; 950.0bp to feature; MODIFIER	silent_mutation	Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0319435119	C -> T	LOC_Os03g34102-LOC_Os03g34120	intergenic_region ; MODIFIER	silent_mutation	Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N
vg0319435119	C -> DEL	N	N	silent_mutation	Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319435119	NA	1.62E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	6.23E-09	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	3.09E-07	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	4.98E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	2.35E-06	5.25E-06	mr1588	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	4.48E-09	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	2.88E-17	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	1.52E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	NA	7.71E-12	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319435119	3.17E-09	9.58E-29	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251