| Variant ID: vg0319435119 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19435119 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, others allele: 0.00, population size: 68. )
GGCAAGAACAAGCAAACCAAGAGAGGAGACACGTTGATTTGTTTCCCGAAGTTCGGATCCACGGATCCTACATCTTCGTTGAGGGGCCACAAGACCGGGT[C/T]
TATTTCAACCCTTTCCTCACGAGGTTGCACAAATGCACTCCTCGGTTTCACTCTTGATTTCTTCCCTTGCGGAGGCGAAATCGAAGCCTTCACAAACTTT
AAAGTTTGTGAAGGCTTCGATTTCGCCTCCGCAAGGGAAGAAATCAAGAGTGAAACCGAGGAGTGCATTTGTGCAACCTCGTGAGGAAAGGGTTGAAATA[G/A]
ACCCGGTCTTGTGGCCCCTCAACGAAGATGTAGGATCCGTGGATCCGAACTTCGGGAAACAAATCAACGTGTCTCCTCTCTTGGTTTGCTTGTTCTTGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 32.80% | 0.40% | 0.53% | NA |
| All Indica | 2759 | 95.40% | 3.90% | 0.65% | 0.11% | NA |
| All Japonica | 1512 | 12.80% | 85.80% | 0.00% | 1.46% | NA |
| Aus | 269 | 89.20% | 10.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.10% | 2.20% | 1.68% | 0.00% | NA |
| Indica II | 465 | 94.80% | 4.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 5.60% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 33.90% | 65.90% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.90% | 83.40% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319435119 | C -> T | LOC_Os03g34096.1 | upstream_gene_variant ; 3606.0bp to feature; MODIFIER | silent_mutation | Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0319435119 | C -> T | LOC_Os03g34102.1 | upstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0319435119 | C -> T | LOC_Os03g34102-LOC_Os03g34120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0319435119 | C -> DEL | N | N | silent_mutation | Average:45.717; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319435119 | NA | 1.62E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 6.23E-09 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 3.09E-07 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 4.98E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | 2.35E-06 | 5.25E-06 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 4.48E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 2.88E-17 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 1.52E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | NA | 7.71E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319435119 | 3.17E-09 | 9.58E-29 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/