\
| Variant ID: vg0319434107 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19434107 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATTGGCATCCTTGTTAGGCTTGCCACAGAATGGGCTAGCCTTCGCCATCATGATGAGGCTGGACTTCAAGTCGAAATCCACGTCTCCCATGTTGATTTG[T/C]
GGCCCAATGGCCACATTGTCAGCAGAGGGAGCAGCAAACTCGCGAAGGGTCTTGTCAGCCATAGTCTTGAAGGTTGGTGGCGCTGGTACGACTGGTTTCT
AGAAACCAGTCGTACCAGCGCCACCAACCTTCAAGACTATGGCTGACAAGACCCTTCGCGAGTTTGCTGCTCCCTCTGCTGACAATGTGGCCATTGGGCC[A/G]
CAAATCAACATGGGAGACGTGGATTTCGACTTGAAGTCCAGCCTCATCATGATGGCGAAGGCTAGCCCATTCTGTGGCAAGCCTAACAAGGATGCCAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 31.40% | 1.21% | 3.07% | NA |
| All Indica | 2759 | 91.80% | 2.10% | 1.85% | 4.24% | NA |
| All Japonica | 1512 | 12.80% | 85.50% | 0.00% | 1.65% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.20% | 1.20% | 6.22% | 3.36% | NA |
| Indica II | 465 | 94.20% | 2.60% | 0.65% | 2.58% | NA |
| Indica III | 913 | 93.30% | 1.00% | 0.33% | 5.37% | NA |
| Indica Intermediate | 786 | 90.60% | 3.80% | 1.02% | 4.58% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 82.60% | 0.00% | 9.96% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 42.20% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319434107 | T -> C | LOC_Os03g34102.1 | synonymous_variant ; p.Pro21Pro; LOW | synonymous_codon | Average:59.223; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0319434107 | T -> C | LOC_Os03g34102.1 | synonymous_variant ; p.Pro21Pro; LOW | nonsynonymous_codon ; P21L | Average:59.223; most accessible tissue: Minghui63 flag leaf, score: 79.962 | benign |
0.336 |
TOLERATED | 0.10 |
| vg0319434107 | T -> DEL | LOC_Os03g34102.1 | N | frameshift_variant | Average:59.223; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319434107 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 4.01E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 5.23E-06 | NA | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 1.52E-14 | 2.74E-19 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 3.12E-06 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 3.46E-09 | 1.69E-20 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 3.82E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 9.96E-16 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 5.57E-06 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 2.53E-11 | 1.29E-18 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 4.51E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | 7.09E-09 | 1.43E-27 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 2.72E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 5.64E-14 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319434107 | NA | 4.38E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |