\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319387507:

Variant ID: vg0319387507 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19387507
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACATGCATCATGTAGACTAACCCAGTAAGCTTCATGAATTTTGGCATAATTTTTAGACCCCTGCATCATAGTGAAACAATCTAGATACTTAGCATAAT[C/T]
ATATTCTGGAAATTTGTAGTAGCTGCATTCATCTTTTCATGTAGCCCAAAACATAATTGATAAAATATGCATCTTTTTACAGTAGTTTTCATACATAACC

Reverse complement sequence

GGTTATGTATGAAAACTACTGTAAAAAGATGCATATTTTATCAATTATGTTTTGGGCTACATGAAAAGATGAATGCAGCTACTACAAATTTCCAGAATAT[G/A]
ATTATGCTAAGTATCTAGATTGTTTCACTATGATGCAGGGGTCTAAAAATTATGCCAAAATTCATGAAGCTTACTGGGTTAGTCTACATGATGCATGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 7.80% 8.40% 36.80% NA
All Indica  2759 23.40% 9.00% 11.63% 55.96% NA
All Japonica  1512 87.60% 7.10% 1.79% 3.51% NA
Aus  269 40.10% 1.50% 13.38% 44.98% NA
Indica I  595 28.20% 1.50% 12.44% 57.82% NA
Indica II  465 32.30% 4.10% 17.85% 45.81% NA
Indica III  913 11.00% 17.10% 7.45% 64.51% NA
Indica Intermediate  786 29.00% 8.10% 12.21% 50.64% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 69.60% 16.50% 4.37% 9.52% NA
Japonica Intermediate  241 85.90% 10.40% 2.07% 1.66% NA
VI/Aromatic  96 88.50% 1.00% 6.25% 4.17% NA
Intermediate  90 65.60% 7.80% 7.78% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319387507 C -> T LOC_Os03g33970.1 upstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:7.942; most accessible tissue: Callus, score: 20.009 N N N N
vg0319387507 C -> T LOC_Os03g33980.1 upstream_gene_variant ; 2314.0bp to feature; MODIFIER silent_mutation Average:7.942; most accessible tissue: Callus, score: 20.009 N N N N
vg0319387507 C -> T LOC_Os03g33970-LOC_Os03g33980 intergenic_region ; MODIFIER silent_mutation Average:7.942; most accessible tissue: Callus, score: 20.009 N N N N
vg0319387507 C -> DEL N N silent_mutation Average:7.942; most accessible tissue: Callus, score: 20.009 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319387507 NA 6.34E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 6.39E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 1.79E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 4.98E-09 4.98E-09 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 6.17E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 4.39E-08 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 1.54E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319387507 NA 9.27E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251