\
| Variant ID: vg0319387507 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19387507 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACATGCATCATGTAGACTAACCCAGTAAGCTTCATGAATTTTGGCATAATTTTTAGACCCCTGCATCATAGTGAAACAATCTAGATACTTAGCATAAT[C/T]
ATATTCTGGAAATTTGTAGTAGCTGCATTCATCTTTTCATGTAGCCCAAAACATAATTGATAAAATATGCATCTTTTTACAGTAGTTTTCATACATAACC
GGTTATGTATGAAAACTACTGTAAAAAGATGCATATTTTATCAATTATGTTTTGGGCTACATGAAAAGATGAATGCAGCTACTACAAATTTCCAGAATAT[G/A]
ATTATGCTAAGTATCTAGATTGTTTCACTATGATGCAGGGGTCTAAAAATTATGCCAAAATTCATGAAGCTTACTGGGTTAGTCTACATGATGCATGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.00% | 7.80% | 8.40% | 36.80% | NA |
| All Indica | 2759 | 23.40% | 9.00% | 11.63% | 55.96% | NA |
| All Japonica | 1512 | 87.60% | 7.10% | 1.79% | 3.51% | NA |
| Aus | 269 | 40.10% | 1.50% | 13.38% | 44.98% | NA |
| Indica I | 595 | 28.20% | 1.50% | 12.44% | 57.82% | NA |
| Indica II | 465 | 32.30% | 4.10% | 17.85% | 45.81% | NA |
| Indica III | 913 | 11.00% | 17.10% | 7.45% | 64.51% | NA |
| Indica Intermediate | 786 | 29.00% | 8.10% | 12.21% | 50.64% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 69.60% | 16.50% | 4.37% | 9.52% | NA |
| Japonica Intermediate | 241 | 85.90% | 10.40% | 2.07% | 1.66% | NA |
| VI/Aromatic | 96 | 88.50% | 1.00% | 6.25% | 4.17% | NA |
| Intermediate | 90 | 65.60% | 7.80% | 7.78% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319387507 | C -> T | LOC_Os03g33970.1 | upstream_gene_variant ; 4570.0bp to feature; MODIFIER | silent_mutation | Average:7.942; most accessible tissue: Callus, score: 20.009 | N | N | N | N |
| vg0319387507 | C -> T | LOC_Os03g33980.1 | upstream_gene_variant ; 2314.0bp to feature; MODIFIER | silent_mutation | Average:7.942; most accessible tissue: Callus, score: 20.009 | N | N | N | N |
| vg0319387507 | C -> T | LOC_Os03g33970-LOC_Os03g33980 | intergenic_region ; MODIFIER | silent_mutation | Average:7.942; most accessible tissue: Callus, score: 20.009 | N | N | N | N |
| vg0319387507 | C -> DEL | N | N | silent_mutation | Average:7.942; most accessible tissue: Callus, score: 20.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319387507 | NA | 6.34E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 6.39E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 1.79E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | 4.98E-09 | 4.98E-09 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 6.17E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 4.39E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 1.54E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319387507 | NA | 9.27E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |