\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319354436:

Variant ID: vg0319354436 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19354436
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTTTTCGCCTCCTGCCCTGTTCACGGCACCTTGCTGCGGATACGGCGTGGCAAAGGGCGAAGTCACAGCCTCCGCGTGAGGTTGGGCCATGGAGCTC[G/A]
GCTGCCCGGCTCCGATTGGTGATGCTTGGTGAGCCGCCATGGATGGGTCGAACGATGGCTGGGACCATGCCACGGCGGCCTGGTTTGGTGCTTGGTTTGC

Reverse complement sequence

GCAAACCAAGCACCAAACCAGGCCGCCGTGGCATGGTCCCAGCCATCGTTCGACCCATCCATGGCGGCTCACCAAGCATCACCAATCGGAGCCGGGCAGC[C/T]
GAGCTCCATGGCCCAACCTCACGCGGAGGCTGTGACTTCGCCCTTTGCCACGCCGTATCCGCAGCAAGGTGCCGTGAACAGGGCAGGAGGCGAAAAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.40% 0.11% 0.21% NA
All Indica  2759 88.60% 10.90% 0.18% 0.33% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 61.80% 36.00% 0.67% 1.51% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 91.00% 8.90% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319354436 G -> A LOC_Os03g33880.1 upstream_gene_variant ; 3908.0bp to feature; MODIFIER silent_mutation Average:80.715; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 N N N N
vg0319354436 G -> A LOC_Os03g33890.1 upstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:80.715; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 N N N N
vg0319354436 G -> A LOC_Os03g33870.1 downstream_gene_variant ; 4580.0bp to feature; MODIFIER silent_mutation Average:80.715; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 N N N N
vg0319354436 G -> A LOC_Os03g33900.1 intron_variant ; MODIFIER silent_mutation Average:80.715; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 N N N N
vg0319354436 G -> DEL N N silent_mutation Average:80.715; most accessible tissue: Zhenshan97 flag leaf, score: 90.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0319354436 G A -0.01 -0.01 -0.01 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319354436 NA 9.35E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0319354436 NA 1.19E-10 Spikelet_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0319354436 NA 4.40E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 2.47E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 7.85E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 9.34E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 2.00E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 3.33E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 7.05E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319354436 NA 3.32E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251