\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319343815:

Variant ID: vg0319343815 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19343815
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.22, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTCTTCCGTCGCCGACTGCTTTGTCACCATGGTGGAGCGACTTCATCTTTATTATCTTCGGCACCGGCAAACTCTATTGCCTCTACTTCGCAAGCTTT[A/G]
CTACTTCACCAACCACGACGACTACAAGAGTTTCGACATCTCGGCATACATCACTAAATATGATGCCGTGTTATTTTATTACAACAAGTGGTGTTCCAAT

Reverse complement sequence

ATTGGAACACCACTTGTTGTAATAAAATAACACGGCATCATATTTAGTGATGTATGCCGAGATGTCGAAACTCTTGTAGTCGTCGTGGTTGGTGAAGTAG[T/C]
AAAGCTTGCGAAGTAGAGGCAATAGAGTTTGCCGGTGCCGAAGATAATAAAGATGAAGTCGCTCCACCATGGTGACAAAGCAGTCGGCGACGGAAGAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 0.50% 31.91% 26.79% NA
All Indica  2759 14.40% 0.50% 46.54% 38.53% NA
All Japonica  1512 88.40% 0.00% 2.05% 9.52% NA
Aus  269 23.00% 3.70% 59.85% 13.38% NA
Indica I  595 18.50% 0.00% 34.29% 47.23% NA
Indica II  465 15.50% 0.90% 48.82% 34.84% NA
Indica III  913 8.10% 0.90% 55.64% 35.38% NA
Indica Intermediate  786 18.10% 0.30% 43.89% 37.79% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 72.20% 0.00% 5.16% 22.62% NA
Japonica Intermediate  241 85.90% 0.00% 2.07% 12.03% NA
VI/Aromatic  96 74.00% 0.00% 19.79% 6.25% NA
Intermediate  90 66.70% 0.00% 14.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319343815 A -> DEL N N silent_mutation Average:14.555; most accessible tissue: Callus, score: 26.785 N N N N
vg0319343815 A -> G LOC_Os03g33870.1 upstream_gene_variant ; 3917.0bp to feature; MODIFIER silent_mutation Average:14.555; most accessible tissue: Callus, score: 26.785 N N N N
vg0319343815 A -> G LOC_Os03g33860.1 downstream_gene_variant ; 1952.0bp to feature; MODIFIER silent_mutation Average:14.555; most accessible tissue: Callus, score: 26.785 N N N N
vg0319343815 A -> G LOC_Os03g33860-LOC_Os03g33870 intergenic_region ; MODIFIER silent_mutation Average:14.555; most accessible tissue: Callus, score: 26.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319343815 NA 5.95E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 7.54E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 3.58E-06 NA mr1170 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 5.72E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 4.67E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 1.18E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 6.31E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 8.77E-06 mr1352 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 2.14E-06 2.14E-06 mr1362 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 5.45E-06 5.45E-06 mr1384 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 2.13E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 9.85E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 4.92E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 4.31E-11 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 1.23E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 2.01E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 7.35E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319343815 NA 3.52E-14 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251