Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319337714:

Variant ID: vg0319337714 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19337714
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGGTGATCGGCGTGGAAGTACGGCGAGGAGAACGCACGAGAAGGAGAAGGTCGAGC[T/C]
GGTGCGATCGACTAGTTCCTCTACATCGACGCGCGCTACTTCGCGAGACTTTTTTCGACTTCTTAGCGCCTTTTTCCGCTGCGCAGCGCGTCGAGTGGTA

Reverse complement sequence

TACCACTCGACGCGCTGCGCAGCGGAAAAAGGCGCTAAGAAGTCGAAAAAAGTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAACTAGTCGATCGCACC[A/G]
GCTCGACCTTCTCCTTCTCGTGCGTTCTCCTCGCCGTACTTCCACGCCGATCACCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	33.30%	0.21%	3.24%	NA
All Indica	2759	90.20%	4.80%	0.25%	4.75%	NA
All Japonica	1512	12.80%	85.90%	0.07%	1.26%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	93.10%	6.20%	0.17%	0.50%	NA
Indica II	465	81.50%	3.90%	0.00%	14.62%	NA
Indica III	913	95.80%	1.40%	0.11%	2.63%	NA
Indica Intermediate	786	86.60%	8.10%	0.64%	4.58%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.50%	84.60%	0.41%	7.47%	NA
VI/Aromatic	96	25.00%	71.90%	1.04%	2.08%	NA
Intermediate	90	43.30%	54.40%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319337714	T -> C	LOC_Os03g33860.1	upstream_gene_variant ; 3007.0bp to feature; MODIFIER	silent_mutation	Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0319337714	T -> C	LOC_Os03g33850.1	downstream_gene_variant ; 1184.0bp to feature; MODIFIER	silent_mutation	Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0319337714	T -> C	LOC_Os03g33850-LOC_Os03g33860	intergenic_region ; MODIFIER	silent_mutation	Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0319337714	T -> DEL	N	N	silent_mutation	Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319337714	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	6.27E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	4.39E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	1.18E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	1.33E-08	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	2.33E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	1.44E-07	2.24E-17	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	7.71E-10	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	1.49E-06	1.49E-06	mr1827	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	2.00E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	NA	5.92E-11	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714	2.45E-08	1.53E-24	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251