\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319337714:

Variant ID: vg0319337714 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19337714
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGGTGATCGGCGTGGAAGTACGGCGAGGAGAACGCACGAGAAGGAGAAGGTCGAGC[T/C]
GGTGCGATCGACTAGTTCCTCTACATCGACGCGCGCTACTTCGCGAGACTTTTTTCGACTTCTTAGCGCCTTTTTCCGCTGCGCAGCGCGTCGAGTGGTA

Reverse complement sequence

TACCACTCGACGCGCTGCGCAGCGGAAAAAGGCGCTAAGAAGTCGAAAAAAGTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAACTAGTCGATCGCACC[A/G]
GCTCGACCTTCTCCTTCTCGTGCGTTCTCCTCGCCGTACTTCCACGCCGATCACCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 33.30% 0.21% 3.24% NA
All Indica  2759 90.20% 4.80% 0.25% 4.75% NA
All Japonica  1512 12.80% 85.90% 0.07% 1.26% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 93.10% 6.20% 0.17% 0.50% NA
Indica II  465 81.50% 3.90% 0.00% 14.62% NA
Indica III  913 95.80% 1.40% 0.11% 2.63% NA
Indica Intermediate  786 86.60% 8.10% 0.64% 4.58% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 84.60% 0.41% 7.47% NA
VI/Aromatic  96 25.00% 71.90% 1.04% 2.08% NA
Intermediate  90 43.30% 54.40% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319337714 T -> C LOC_Os03g33860.1 upstream_gene_variant ; 3007.0bp to feature; MODIFIER silent_mutation Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0319337714 T -> C LOC_Os03g33850.1 downstream_gene_variant ; 1184.0bp to feature; MODIFIER silent_mutation Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0319337714 T -> C LOC_Os03g33850-LOC_Os03g33860 intergenic_region ; MODIFIER silent_mutation Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N
vg0319337714 T -> DEL N N silent_mutation Average:66.536; most accessible tissue: Minghui63 young leaf, score: 79.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319337714 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 6.27E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 4.39E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 1.18E-19 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 1.33E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 2.33E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 1.44E-07 2.24E-17 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 7.71E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 1.49E-06 1.49E-06 mr1827 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 2.00E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 NA 5.92E-11 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337714 2.45E-08 1.53E-24 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251