\
| Variant ID: vg0319337674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19337674 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCGCGCTCGGGTGCTAGCACATTTGCGCGTGGCGTTTCGTCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGGTGATCGGCGTGGA[A/T]
GTACGGCGAGGAGAACGCACGAGAAGGAGAAGGTCGAGCTGGTGCGATCGACTAGTTCCTCTACATCGACGCGCGCTACTTCGCGAGACTTTTTTCGACT
AGTCGAAAAAAGTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAACTAGTCGATCGCACCAGCTCGACCTTCTCCTTCTCGTGCGTTCTCCTCGCCGTAC[T/A]
TCCACGCCGATCACCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGACGAAACGCCACGCGCAAATGTGCTAGCACCCGAGCGCGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 2.80% | 1.04% | 2.14% | NA |
| All Indica | 2759 | 95.60% | 0.00% | 1.34% | 3.04% | NA |
| All Japonica | 1512 | 89.80% | 8.50% | 0.73% | 0.99% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.00% | 0.84% | 0.17% | NA |
| Indica II | 465 | 86.50% | 0.00% | 2.58% | 10.97% | NA |
| Indica III | 913 | 97.80% | 0.00% | 0.77% | 1.42% | NA |
| Indica Intermediate | 786 | 95.90% | 0.00% | 1.65% | 2.42% | NA |
| Temperate Japonica | 767 | 97.50% | 2.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 83.90% | 14.70% | 1.19% | 0.20% | NA |
| Japonica Intermediate | 241 | 77.60% | 14.90% | 1.66% | 5.81% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319337674 | A -> T | LOC_Os03g33860.1 | upstream_gene_variant ; 3047.0bp to feature; MODIFIER | silent_mutation | Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0319337674 | A -> T | LOC_Os03g33850.1 | downstream_gene_variant ; 1144.0bp to feature; MODIFIER | silent_mutation | Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0319337674 | A -> T | LOC_Os03g33850-LOC_Os03g33860 | intergenic_region ; MODIFIER | silent_mutation | Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| vg0319337674 | A -> DEL | N | N | silent_mutation | Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319337674 | 7.83E-06 | 7.83E-06 | mr1643 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319337674 | NA | 4.11E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319337674 | 4.32E-07 | 4.32E-07 | mr1610_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319337674 | NA | 3.33E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319337674 | 1.53E-06 | 1.53E-06 | mr1897_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |