\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319337674:

Variant ID: vg0319337674 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19337674
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGCGCTCGGGTGCTAGCACATTTGCGCGTGGCGTTTCGTCCCTGTACGTGTGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGGTGATCGGCGTGGA[A/T]
GTACGGCGAGGAGAACGCACGAGAAGGAGAAGGTCGAGCTGGTGCGATCGACTAGTTCCTCTACATCGACGCGCGCTACTTCGCGAGACTTTTTTCGACT

Reverse complement sequence

AGTCGAAAAAAGTCTCGCGAAGTAGCGCGCGTCGATGTAGAGGAACTAGTCGATCGCACCAGCTCGACCTTCTCCTTCTCGTGCGTTCTCCTCGCCGTAC[T/A]
TCCACGCCGATCACCACCGCAAACCAGCGGCGCCTCTACCGGTATCCACACGTACAGGGACGAAACGCCACGCGCAAATGTGCTAGCACCCGAGCGCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 2.80% 1.04% 2.14% NA
All Indica  2759 95.60% 0.00% 1.34% 3.04% NA
All Japonica  1512 89.80% 8.50% 0.73% 0.99% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 0.84% 0.17% NA
Indica II  465 86.50% 0.00% 2.58% 10.97% NA
Indica III  913 97.80% 0.00% 0.77% 1.42% NA
Indica Intermediate  786 95.90% 0.00% 1.65% 2.42% NA
Temperate Japonica  767 97.50% 2.30% 0.13% 0.00% NA
Tropical Japonica  504 83.90% 14.70% 1.19% 0.20% NA
Japonica Intermediate  241 77.60% 14.90% 1.66% 5.81% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319337674 A -> T LOC_Os03g33860.1 upstream_gene_variant ; 3047.0bp to feature; MODIFIER silent_mutation Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0319337674 A -> T LOC_Os03g33850.1 downstream_gene_variant ; 1144.0bp to feature; MODIFIER silent_mutation Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0319337674 A -> T LOC_Os03g33850-LOC_Os03g33860 intergenic_region ; MODIFIER silent_mutation Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg0319337674 A -> DEL N N silent_mutation Average:55.844; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319337674 7.83E-06 7.83E-06 mr1643 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337674 NA 4.11E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337674 4.32E-07 4.32E-07 mr1610_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337674 NA 3.33E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319337674 1.53E-06 1.53E-06 mr1897_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251