\
| Variant ID: vg0319300846 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19300846 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAACATTAGGCAACGTGGCAACGCGCAAGACCCAAGGCTGCAGCAGGGAACAACTGTCGAAGCACCCCGCGAAGCAGTTCAAGAACAAACACCCCCGGTC[G/A]
AACAACGTCAAGACGTGCAACAAAGGGTAATCCAAGTGATTACGAGGGCCGACCCGCCAGGCCAATTATCTAAAAGGCAGAAAAAGATGCAGATCTGAGC
GCTCAGATCTGCATCTTTTTCTGCCTTTTAGATAATTGGCCTGGCGGGTCGGCCCTCGTAATCACTTGGATTACCCTTTGTTGCACGTCTTGACGTTGTT[C/T]
GACCGGGGGTGTTTGTTCTTGAACTGCTTCGCGGGGTGCTTCGACAGTTGTTCCCTGCTGCAGCCTTGGGTCTTGCGCGTTGCCACGTTGCCTAATGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 12.50% | 3.17% | 0.02% | NA |
| All Indica | 2759 | 95.80% | 1.80% | 2.39% | 0.00% | NA |
| All Japonica | 1512 | 65.90% | 29.00% | 5.03% | 0.00% | NA |
| Aus | 269 | 90.30% | 7.80% | 1.49% | 0.37% | NA |
| Indica I | 595 | 96.10% | 1.50% | 2.35% | 0.00% | NA |
| Indica II | 465 | 94.20% | 1.30% | 4.52% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 3.20% | 3.82% | 0.00% | NA |
| Temperate Japonica | 767 | 90.50% | 4.40% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 42.90% | 54.40% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.10% | 54.40% | 9.54% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 66.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 21.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319300846 | G -> A | LOC_Os03g33760.1 | missense_variant ; p.Glu631Lys; MODERATE | nonsynonymous_codon ; E631K | Average:40.799; most accessible tissue: Minghui63 flag leaf, score: 61.847 | benign |
0.278 |
DELETERIOUS | 0.05 |
| vg0319300846 | G -> DEL | LOC_Os03g33760.1 | N | frameshift_variant | Average:40.799; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319300846 | NA | 2.07E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0319300846 | NA | 3.14E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 4.75E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 9.35E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 2.94E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 6.58E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 8.59E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | 5.17E-07 | 1.46E-06 | mr1482 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 4.84E-07 | mr1482 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 5.39E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 1.15E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 7.98E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 9.86E-08 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 1.85E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319300846 | NA | 1.17E-16 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |