\
| Variant ID: vg0319293489 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19293489 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 50. )
TCAGAAGCGTTTGAAGAAGCTCAAGGCAAGTCACACAGATCCCAAAAAAACCCTTTGAGCATGTTGAACCCGTTTAAAGCTAATGTTTTATTTCAACTTA[T/C]
GCATTATTTTCGAATGCGATCGGGTGGTGAGCCATTCCTAATTTCCCAGAGGGAAATCTGTGAAGAAGCTCAAGCAGGTTGCTAATGAGGTCGGTTTGCT
AGCAAACCGACCTCATTAGCAACCTGCTTGAGCTTCTTCACAGATTTCCCTCTGGGAAATTAGGAATGGCTCACCACCCGATCGCATTCGAAAATAATGC[A/G]
TAAGTTGAAATAAAACATTAGCTTTAAACGGGTTCAACATGCTCAAAGGGTTTTTTTGGGATCTGTGTGACTTGCCTTGAGCTTCTTCAAACGCTTCTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 39.30% | 1.04% | 1.59% | NA |
| All Indica | 2759 | 31.90% | 63.90% | 1.56% | 2.65% | NA |
| All Japonica | 1512 | 99.00% | 0.80% | 0.13% | 0.07% | NA |
| Aus | 269 | 82.50% | 17.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 46.20% | 51.80% | 1.34% | 0.67% | NA |
| Indica II | 465 | 24.50% | 68.00% | 3.01% | 4.52% | NA |
| Indica III | 913 | 30.70% | 67.00% | 0.33% | 1.97% | NA |
| Indica Intermediate | 786 | 26.70% | 67.20% | 2.29% | 3.82% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319293489 | T -> C | LOC_Os03g33750.1 | upstream_gene_variant ; 274.0bp to feature; MODIFIER | silent_mutation | Average:61.775; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0319293489 | T -> C | LOC_Os03g33740.1 | downstream_gene_variant ; 3130.0bp to feature; MODIFIER | silent_mutation | Average:61.775; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0319293489 | T -> C | LOC_Os03g33740-LOC_Os03g33750 | intergenic_region ; MODIFIER | silent_mutation | Average:61.775; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0319293489 | T -> DEL | N | N | silent_mutation | Average:61.775; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319293489 | NA | 8.17E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 1.60E-07 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 2.06E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 3.56E-07 | mr1735 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 3.01E-07 | mr1735 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 1.38E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 2.49E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 4.89E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 7.10E-07 | mr1844 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 3.33E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 1.93E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 4.96E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319293489 | NA | 2.25E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |