\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319282672:

Variant ID: vg0319282672 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19282672
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTGGTGCTTCCATCTTTATGACACTCTAATCTTGTTTATGTAATTC[G/A]
TCGAGTTATCATATATCCTACATAATCCCTGGCAATATTGATATCTAACCTACAATCGGCTAATGTCCGTTAATAGAAGGCAGCCGATTAAGTTAAATAC

Reverse complement sequence

GTATTTAACTTAATCGGCTGCCTTCTATTAACGGACATTAGCCGATTGTAGGTTAGATATCAATATTGCCAGGGATTATGTAGGATATATGATAACTCGA[C/T]
GAATTACATAAACAAGATTAGAGTGTCATAAAGATGGAAGCACCAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 45.90% 2.41% 0.21% NA
All Indica  2759 76.40% 19.60% 3.99% 0.00% NA
All Japonica  1512 1.80% 97.50% 0.07% 0.66% NA
Aus  269 88.80% 10.80% 0.37% 0.00% NA
Indica I  595 90.30% 8.20% 1.51% 0.00% NA
Indica II  465 71.60% 20.00% 8.39% 0.00% NA
Indica III  913 68.50% 29.00% 2.52% 0.00% NA
Indica Intermediate  786 78.00% 17.00% 4.96% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 93.80% 0.41% 4.15% NA
VI/Aromatic  96 25.00% 72.90% 2.08% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319282672 G -> A LOC_Os03g33730.1 upstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:18.589; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0319282672 G -> A LOC_Os03g33740.1 upstream_gene_variant ; 4807.0bp to feature; MODIFIER silent_mutation Average:18.589; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0319282672 G -> A LOC_Os03g33720.1 downstream_gene_variant ; 4363.0bp to feature; MODIFIER silent_mutation Average:18.589; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0319282672 G -> A LOC_Os03g33730-LOC_Os03g33740 intergenic_region ; MODIFIER silent_mutation Average:18.589; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0319282672 G -> DEL N N silent_mutation Average:18.589; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319282672 6.37E-06 NA mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282672 1.42E-06 5.19E-06 mr1199_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251