\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319282541:

Variant ID: vg0319282541 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19282541
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGGTATAAATAGACCCCGAGCCCTATGTAACTTTAAGAACACACGTTCAATACAATCTCGGCGCATCGCCACCCTTTTTTGTTTTAGTTTTATTTCGA[T/C]
GAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTGGTGCTTCCATCTT

Reverse complement sequence

AAGATGGAAGCACCAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTC[A/G]
TCGAAATAAAACTAAAACAAAAAAGGGTGGCGATGCGCCGAGATTGTATTGAACGTGTGTTCTTAAAGTTACATAGGGCTCGGGGTCTATTTATACCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 32.70% 2.56% 0.23% NA
All Indica  2759 89.80% 6.10% 4.13% 0.04% NA
All Japonica  1512 17.30% 81.90% 0.20% 0.66% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 91.40% 5.40% 3.19% 0.00% NA
Indica II  465 82.60% 9.50% 7.96% 0.00% NA
Indica III  913 95.60% 2.00% 2.41% 0.00% NA
Indica Intermediate  786 86.00% 9.30% 4.58% 0.13% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 38.10% 61.90% 0.00% 0.00% NA
Japonica Intermediate  241 26.60% 68.50% 0.83% 4.15% NA
VI/Aromatic  96 26.00% 71.90% 2.08% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319282541 T -> C LOC_Os03g33730.1 upstream_gene_variant ; 757.0bp to feature; MODIFIER silent_mutation Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0319282541 T -> C LOC_Os03g33740.1 upstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0319282541 T -> C LOC_Os03g33720.1 downstream_gene_variant ; 4232.0bp to feature; MODIFIER silent_mutation Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0319282541 T -> C LOC_Os03g33730-LOC_Os03g33740 intergenic_region ; MODIFIER silent_mutation Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0319282541 T -> DEL N N silent_mutation Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319282541 NA 6.14E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 6.17E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 9.09E-06 9.09E-06 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 1.77E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 1.94E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 5.83E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 8.60E-06 mr1607 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 8.35E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 NA 9.92E-09 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319282541 7.74E-06 1.86E-08 mr1866 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251