\
| Variant ID: vg0319282541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19282541 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCGGGTATAAATAGACCCCGAGCCCTATGTAACTTTAAGAACACACGTTCAATACAATCTCGGCGCATCGCCACCCTTTTTTGTTTTAGTTTTATTTCGA[T/C]
GAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTGGTGCTTCCATCTT
AAGATGGAAGCACCAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTC[A/G]
TCGAAATAAAACTAAAACAAAAAAGGGTGGCGATGCGCCGAGATTGTATTGAACGTGTGTTCTTAAAGTTACATAGGGCTCGGGGTCTATTTATACCCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 32.70% | 2.56% | 0.23% | NA |
| All Indica | 2759 | 89.80% | 6.10% | 4.13% | 0.04% | NA |
| All Japonica | 1512 | 17.30% | 81.90% | 0.20% | 0.66% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 5.40% | 3.19% | 0.00% | NA |
| Indica II | 465 | 82.60% | 9.50% | 7.96% | 0.00% | NA |
| Indica III | 913 | 95.60% | 2.00% | 2.41% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 9.30% | 4.58% | 0.13% | NA |
| Temperate Japonica | 767 | 0.70% | 99.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 38.10% | 61.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.60% | 68.50% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 26.00% | 71.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 48.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319282541 | T -> C | LOC_Os03g33730.1 | upstream_gene_variant ; 757.0bp to feature; MODIFIER | silent_mutation | Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0319282541 | T -> C | LOC_Os03g33740.1 | upstream_gene_variant ; 4938.0bp to feature; MODIFIER | silent_mutation | Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0319282541 | T -> C | LOC_Os03g33720.1 | downstream_gene_variant ; 4232.0bp to feature; MODIFIER | silent_mutation | Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0319282541 | T -> C | LOC_Os03g33730-LOC_Os03g33740 | intergenic_region ; MODIFIER | silent_mutation | Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0319282541 | T -> DEL | N | N | silent_mutation | Average:23.178; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319282541 | NA | 6.14E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 6.17E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | 9.09E-06 | 9.09E-06 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 1.77E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 1.94E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 5.83E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 8.60E-06 | mr1607 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 8.35E-07 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | NA | 9.92E-09 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319282541 | 7.74E-06 | 1.86E-08 | mr1866 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |