\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319269647:

Variant ID: vg0319269647 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19269647
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGGGCGAAGGCCCTAGTTGCGTTCTCGTCGGGCAAGGCGGCGAAGGTAGGTCCGGTCAAGAAGATCTCTAAAAAGAAAGGACTCGTCGACATCGCTC[A/G]
CGTTTTCAGCGACGACGAGTCTTCTGACGAGACTCCGACTTCACCCGATGGCCGCAGTCTAGACCTTTCGACCGCTCCCCTTCTTCCACTCGGCGTTGCT

Reverse complement sequence

AGCAACGCCGAGTGGAAGAAGGGGAGCGGTCGAAAGGTCTAGACTGCGGCCATCGGGTGAAGTCGGAGTCTCGTCAGAAGACTCGTCGTCGCTGAAAACG[T/C]
GAGCGATGTCGACGAGTCCTTTCTTTTTAGAGATCTTCTTGACCGGACCTACCTTCGCCGCCTTGCCCGACGAGAACGCAACTAGGGCCTTCGCCCCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 32.10% 2.01% 1.71% NA
All Indica  2759 91.60% 3.00% 2.61% 2.72% NA
All Japonica  1512 12.80% 85.70% 1.12% 0.33% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 95.10% 1.50% 1.18% 2.18% NA
Indica II  465 82.80% 6.00% 5.16% 6.02% NA
Indica III  913 96.40% 1.40% 1.42% 0.77% NA
Indica Intermediate  786 88.70% 4.30% 3.56% 3.44% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.20% 0.00% NA
Japonica Intermediate  241 7.90% 83.40% 6.64% 2.07% NA
VI/Aromatic  96 25.00% 71.90% 3.12% 0.00% NA
Intermediate  90 51.10% 44.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319269647 A -> DEL LOC_Os03g33690.1 N frameshift_variant Average:61.44; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 N N N N
vg0319269647 A -> G LOC_Os03g33690.1 missense_variant ; p.His293Arg; MODERATE nonsynonymous_codon ; H293R Average:61.44; most accessible tissue: Zhenshan97 flag leaf, score: 84.585 probably damaging -2.33 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319269647 NA 3.79E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 7.24E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.76E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.58E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 3.16E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 2.81E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 6.69E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 3.55E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 1.23E-06 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 4.30E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.16E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 6.51E-07 1.79E-07 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 8.33E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 2.02E-25 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.66E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.87E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.33E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 5.98E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 1.08E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 2.60E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 5.02E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 2.39E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319269647 NA 3.74E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251