\
| Variant ID: vg0319208851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19208851 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATATTAACAATGAGACTATATACATTCATAGCATAGCCGATCAGATAGATCTAGCATGTAT[C/T]
GGCTAATACCCCGATACCACCTTATATTAAGATATTAAAGCAAGTAGAATATACTAATCAACAGCCTAATATACTTAAATGTAGCAAGATCTTAACGTAA
TTACGTTAAGATCTTGCTACATTTAAGTATATTAGGCTGTTGATTAGTATATTCTACTTGCTTTAATATCTTAATATAAGGTGGTATCGGGGTATTAGCC[G/A]
ATACATGCTAGATCTATCTGATCGGCTATGCTATGAATGTATATAGTCTCATTGTTAATATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 9.00% | 3.09% | 0.32% | NA |
| All Indica | 2759 | 79.80% | 15.10% | 5.04% | 0.07% | NA |
| All Japonica | 1512 | 98.70% | 0.30% | 0.20% | 0.86% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 6.70% | 10.08% | 0.00% | NA |
| Indica II | 465 | 95.70% | 1.10% | 3.23% | 0.00% | NA |
| Indica III | 913 | 70.80% | 28.10% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 14.50% | 6.87% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.40% | 1.24% | 4.98% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319208851 | C -> T | LOC_Os03g33590.1 | upstream_gene_variant ; 4761.0bp to feature; MODIFIER | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0319208851 | C -> T | LOC_Os03g33600.1 | upstream_gene_variant ; 453.0bp to feature; MODIFIER | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0319208851 | C -> T | LOC_Os03g33590.2 | upstream_gene_variant ; 4761.0bp to feature; MODIFIER | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0319208851 | C -> T | LOC_Os03g33610.1 | downstream_gene_variant ; 3661.0bp to feature; MODIFIER | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0319208851 | C -> T | LOC_Os03g33600-LOC_Os03g33610 | intergenic_region ; MODIFIER | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0319208851 | C -> DEL | N | N | silent_mutation | Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319208851 | NA | 6.76E-08 | mr1221 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 2.47E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 1.13E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 1.30E-06 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 1.76E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 2.03E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 7.18E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319208851 | NA | 1.85E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |