\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319208851:

Variant ID: vg0319208851 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19208851
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATATTAACAATGAGACTATATACATTCATAGCATAGCCGATCAGATAGATCTAGCATGTAT[C/T]
GGCTAATACCCCGATACCACCTTATATTAAGATATTAAAGCAAGTAGAATATACTAATCAACAGCCTAATATACTTAAATGTAGCAAGATCTTAACGTAA

Reverse complement sequence

TTACGTTAAGATCTTGCTACATTTAAGTATATTAGGCTGTTGATTAGTATATTCTACTTGCTTTAATATCTTAATATAAGGTGGTATCGGGGTATTAGCC[G/A]
ATACATGCTAGATCTATCTGATCGGCTATGCTATGAATGTATATAGTCTCATTGTTAATATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 9.00% 3.09% 0.32% NA
All Indica  2759 79.80% 15.10% 5.04% 0.07% NA
All Japonica  1512 98.70% 0.30% 0.20% 0.86% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 83.20% 6.70% 10.08% 0.00% NA
Indica II  465 95.70% 1.10% 3.23% 0.00% NA
Indica III  913 70.80% 28.10% 1.10% 0.00% NA
Indica Intermediate  786 78.40% 14.50% 6.87% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 93.40% 0.40% 1.24% 4.98% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 5.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319208851 C -> T LOC_Os03g33590.1 upstream_gene_variant ; 4761.0bp to feature; MODIFIER silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0319208851 C -> T LOC_Os03g33600.1 upstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0319208851 C -> T LOC_Os03g33590.2 upstream_gene_variant ; 4761.0bp to feature; MODIFIER silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0319208851 C -> T LOC_Os03g33610.1 downstream_gene_variant ; 3661.0bp to feature; MODIFIER silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0319208851 C -> T LOC_Os03g33600-LOC_Os03g33610 intergenic_region ; MODIFIER silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0319208851 C -> DEL N N silent_mutation Average:34.058; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319208851 NA 6.76E-08 mr1221 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 2.47E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 1.13E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 1.30E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 1.76E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 2.03E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 7.18E-06 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851 NA 1.85E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251