Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0319208851:

Variant ID: vg0319208851 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19208851
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATATTAACAATGAGACTATATACATTCATAGCATAGCCGATCAGATAGATCTAGCATGTAT[C/T]
GGCTAATACCCCGATACCACCTTATATTAAGATATTAAAGCAAGTAGAATATACTAATCAACAGCCTAATATACTTAAATGTAGCAAGATCTTAACGTAA

Reverse complement sequence

TTACGTTAAGATCTTGCTACATTTAAGTATATTAGGCTGTTGATTAGTATATTCTACTTGCTTTAATATCTTAATATAAGGTGGTATCGGGGTATTAGCC[G/A]
ATACATGCTAGATCTATCTGATCGGCTATGCTATGAATGTATATAGTCTCATTGTTAATATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	9.00%	3.09%	0.32%	NA
All Indica	2759	79.80%	15.10%	5.04%	0.07%	NA
All Japonica	1512	98.70%	0.30%	0.20%	0.86%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	83.20%	6.70%	10.08%	0.00%	NA
Indica II	465	95.70%	1.10%	3.23%	0.00%	NA
Indica III	913	70.80%	28.10%	1.10%	0.00%	NA
Indica Intermediate	786	78.40%	14.50%	6.87%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.00%	0.20%	NA
Japonica Intermediate	241	93.40%	0.40%	1.24%	4.98%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	5.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319208851	C -> T	LOC_Os03g33590.1	upstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0319208851	C -> T	LOC_Os03g33600.1	upstream_gene_variant ; 453.0bp to feature; MODIFIER	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0319208851	C -> T	LOC_Os03g33590.2	upstream_gene_variant ; 4761.0bp to feature; MODIFIER	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0319208851	C -> T	LOC_Os03g33610.1	downstream_gene_variant ; 3661.0bp to feature; MODIFIER	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0319208851	C -> T	LOC_Os03g33600-LOC_Os03g33610	intergenic_region ; MODIFIER	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0319208851	C -> DEL	N	N	silent_mutation	Average:34.058; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319208851	NA	6.76E-08	mr1221	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	2.47E-09	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	1.13E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	1.30E-06	mr1043_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	1.76E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	2.03E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	7.18E-06	mr1269_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319208851	NA	1.85E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251