Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319153986:

Variant ID: vg0319153986 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19153986
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGCATGAGTAGACCGCCGAGCCACCCGCGCAACCTGATGAACCACATCCTCTCCACCGGACCAATCACTGTCCGAATCATCATGAGAAGATGGAGTGG[G/A,T]
AGAGCGATCCCTCAGGCGCTTGGACTTGTGGGAGGTTTGCTTGCGGGGAGGCATCCTTCAAACAATAGAGATATAAGGAATCAGGTATGGAAGCCAAAGA

Reverse complement sequence

TCTTTGGCTTCCATACCTGATTCCTTATATCTCTATTGTTTGAAGGATGCCTCCCCGCAAGCAAACCTCCCACAAGTCCAAGCGCCTGAGGGATCGCTCT[C/T,A]
CCACTCCATCTTCTCATGATGATTCGGACAGTGATTGGTCCGGTGGAGAGGATGTGGTTCATCAGGTTGCGCGGGTGGCTCGGCGGTCTACTCATGCTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	8.80%	1.08%	5.25%	T: 0.02%
All Indica	2759	81.40%	8.70%	1.78%	8.08%	T: 0.04%
All Japonica	1512	87.40%	11.20%	0.00%	1.39%	NA
Aus	269	98.10%	0.00%	0.74%	1.12%	NA
Indica I	595	63.20%	31.60%	1.34%	3.87%	NA
Indica II	465	92.00%	1.70%	1.29%	4.95%	NA
Indica III	913	84.20%	0.20%	2.19%	13.25%	T: 0.11%
Indica Intermediate	786	85.60%	5.30%	1.91%	7.12%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	69.20%	30.40%	0.00%	0.40%	NA
Japonica Intermediate	241	85.50%	6.60%	0.00%	7.88%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319153986	G -> T	LOC_Os03g33530.1	missense_variant ; p.Pro1563Thr; MODERATE	nonsynonymous_codon ; P1563T	Average:29.957; most accessible tissue: Minghui63 young leaf, score: 61.007	unknown	unknown	TOLERATED	0.18
vg0319153986	G -> A	LOC_Os03g33530.1	missense_variant ; p.Pro1563Ser; MODERATE	nonsynonymous_codon ; P1563S	Average:29.957; most accessible tissue: Minghui63 young leaf, score: 61.007	unknown	unknown	TOLERATED	0.24
vg0319153986	G -> DEL	LOC_Os03g33530.1	N	frameshift_variant	Average:29.957; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319153986	NA	4.45E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	NA	1.31E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	8.69E-06	8.69E-06	mr1362	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	2.57E-06	2.56E-06	mr1849	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	NA	3.66E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	NA	1.17E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319153986	NA	5.12E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251