\
| Variant ID: vg0319141942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19141942 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTTCCGGTTGAAGAGCACAGAGAAATCACGTGAAATATCAAAAATGCCCTTGGGCCCACATGTCGGCACAGTGGAGAGATTTGTGGCGTGGTTGTGCGC[T/C]
GAGATGGAGGTGCTCGGCGTGCTTTGTGTGGCGGCGGACCGGCACCGGTGCCGCGAAGCGCTGTCGCACGCGGCGGTGCGTGCTGCGATGGACGTCGTGG
CCACGACGTCCATCGCAGCACGCACCGCCGCGTGCGACAGCGCTTCGCGGCACCGGTGCCGGTCCGCCGCCACACAAAGCACGCCGAGCACCTCCATCTC[A/G]
GCGCACAACCACGCCACAAATCTCTCCACTGTGCCGACATGTGGGCCCAAGGGCATTTTTGATATTTCACGTGATTTCTCTGTGCTCTTCAACCGGAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 11.30% | 2.92% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 57.90% | 33.70% | 8.40% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 30.10% | 56.50% | 13.43% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 6.90% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 17.40% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 12.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319141942 | T -> C | LOC_Os03g33509.1 | upstream_gene_variant ; 3218.0bp to feature; MODIFIER | silent_mutation | Average:67.327; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| vg0319141942 | T -> C | LOC_Os03g33500.1 | intron_variant ; MODIFIER | silent_mutation | Average:67.327; most accessible tissue: Zhenshan97 young leaf, score: 84.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319141942 | NA | 1.72E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0319141942 | 5.09E-07 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 5.69E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 1.52E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 6.27E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 6.37E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | 6.88E-09 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | 3.39E-06 | 3.18E-06 | mr1354_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 2.93E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319141942 | NA | 5.92E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |