\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319129719:

Variant ID: vg0319129719 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19129719
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCGTCCGTCGTCGCCTTCGGTCGCCGTAGCCTTCATCGGATTCGCAGCTGTAAGGAGAACATCGTCCACCACCTCTTCTTCGCCAAAGATCGCCAGA[A/G]
AGCCGTTGCCGTCGTTGATCAGTACCCCGTCGCCACTCCTGATCTCGTCGCTGGCCATCTCCTTCGTTGTTCATCGCTGCGTAAGTGTTGGTAAGGATCG

Reverse complement sequence

CGATCCTTACCAACACTTACGCAGCGATGAACAACGAAGGAGATGGCCAGCGACGAGATCAGGAGTGGCGACGGGGTACTGATCAACGACGGCAACGGCT[T/C]
TCTGGCGATCTTTGGCGAAGAAGAGGTGGTGGACGATGTTCTCCTTACAGCTGCGAATCCGATGAAGGCTACGGCGACCGAAGGCGACGACGGACGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 40.00% 0.47% 7.26% NA
All Indica  2759 77.90% 10.00% 0.47% 11.56% NA
All Japonica  1512 1.50% 97.00% 0.20% 1.26% NA
Aus  269 89.60% 10.00% 0.37% 0.00% NA
Indica I  595 92.30% 4.50% 0.17% 3.03% NA
Indica II  465 74.00% 19.60% 0.43% 6.02% NA
Indica III  913 69.20% 6.50% 0.55% 23.77% NA
Indica Intermediate  786 79.50% 12.70% 0.64% 7.12% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 90.00% 1.24% 7.88% NA
VI/Aromatic  96 25.00% 71.90% 2.08% 1.04% NA
Intermediate  90 37.80% 54.40% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319129719 A -> DEL LOC_Os03g33490.1 N frameshift_variant Average:41.093; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0319129719 A -> G LOC_Os03g33490.1 missense_variant ; p.Phe20Ser; MODERATE nonsynonymous_codon ; F20S Average:41.093; most accessible tissue: Zhenshan97 panicle, score: 86.058 unknown unknown TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319129719 NA 1.91E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 5.13E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.66E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 7.11E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.14E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.16E-23 mr1588 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 5.53E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.86E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.73E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 1.53E-06 2.88E-115 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.00E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 4.62E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.54E-09 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 1.44E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 1.03E-08 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 1.55E-06 5.72E-14 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319129719 NA 8.24E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251